Query (optional)   in Class  

GrainGenes Probe Report: BE471213-6D

[ Printable Version ]  [ Submit comment/correction ]

Probe
BE471213-6D
Data at Wheat_SNP
BE471213-6D
Reference
ReferenceAkhunov ED et al. (2010) Nucleotide diversity maps reveal variation in diversity among wheat genomes and chromosomes. BMC Genomics 11:702.
General Remarks
SNP T>C;A>G at 603;639
Reference sequence GTCGAAGCGCTGCACTCGTTTATGCAGGATGAGTCCGAGCACAAGTAAGCGCCATTTATATATGCTGACAGATGACTCTGTCTGAATATTCTTTTCTATGTTGGTTGTCGAATGTGTTTACCTTAGGAGGAAACAAAGGAGATCGTATGTGAAAATTCCAGTCACTGTAATGCATTATGTTGCATCGTACTAGTATGATAAGTATGTGTTGGTTCAGTCCATCATTGTGGGTAACTAAATTGTGTTCTCAGAGGAAAGTGCTTAAAATGAAAGATAAATTGCATCTACAGTTTGTAGTCAGTGTTACACCGCAATTGATGATCTACTGTCCAACCTCTGACTTCTTACATTATTTTCCTGAGAAACCGAGAATTTTTTGGTCAACTTTTATTTCCATGCATCTACTGCCTTTTTTTCATCAGCCATGGCCTATCAATCTAAACTCTTTGCTATCCTAATATTTTTCTTGCTCTTAAAAATATGTTTCAGGCATTACCTCATTGTTTCTGCAGTCACAAACCTTTTGGTCAACTTACTTGGTGTCTGGTTCTTCCGGAGCTATGCTCGTGTTAACATAGGTATGAAAGTGATTGGTATCCTGTTTGTCTCTGGCAGAAATGTCAGGATATATACATCTTACCCTTGCTAAGTATCATAATTTGAAAATAGACTGATCAA
Type
EST
SNP
PCR primers
BE471213_cpF1_UCD GTCTTTCTCCTTGGCTGTCG
BE471213D_R1_UCD CTGTACACTAACATTAACAGACAATCAC
Linkage Group
6D
Source Species
Triticum aestivum
Data Source
You, Frank Mingan2010.01