Query (optional)   in Class  

GrainGenes Probe Report: BE471250-4D

[ Printable Version ]  [ Submit comment/correction ]

Probe
BE471250-4D
Data at Wheat_SNP
BE471250-4D
Reference
ReferenceAkhunov ED et al. (2010) Nucleotide diversity maps reveal variation in diversity among wheat genomes and chromosomes. BMC Genomics 11:702.
General Remarks
SNP C>A;A>G;G>C;T>C;C>T at 8;9;10;83;307
Reference sequence CCCGTACCAGTTCTTGAACTCCCTCATCGGCGCGTCCTTCCCGAACCCCCCGCCGCCCCCGGCCCCCGGCGACTGGCTCTCTTCCGCCGCCGGGTTGGACTCGTCGAGGTGCCCGGACGTTCTTGAGGTCAGCCTGGGCGGCCGCGCGGCGGAGCTCGTCCGCGGCGCCACCACGTGCTGCAGCGCGCTGATGACGGTGCGGAGCGCGCGGCTCGGTGACCCGCGGTTGGCGAGCATGATCTCGCCGAGCTCGGCCGGGCTCAGGCGGGCGCCGGCGTGGAAGCCCTCCTCCACCTGAGGGTAAAGCTTGTGGTCCTTGAGGCCCAGGTAGTTGCTGGCCAGCGCCTTGAAGCCGTCGAAGTCGCACATGGTGAAGTG
Type
EST
SNP
Sequence
NSFT03P2_Contig1719
Source Species
Triticum aestivum
Data Source
You, Frank Mingan2010.01