Query (optional)   in Class  

GrainGenes Probe Report: BE488670-7A

[ Printable Version ]  [ Submit comment/correction ]

Probe
BE488670-7A
Data at Wheat_SNP
BE488670-7A
Reference
ReferenceAkhunov ED et al. (2010) Nucleotide diversity maps reveal variation in diversity among wheat genomes and chromosomes. BMC Genomics 11:702.
General Remarks
SNP A>G;A>G;A>G;A>G;A>G;A>G;A>G;A>G;A>G at 73;105;107;109;111;113;115;117;119
Reference sequence ATGCATATGTTTTTTCCTTTTCCTAACATTTGGTGGTCCAGAGTATAAGTAATTTATCAGTTAGCTGTAGCTACTCATTGTTTATATGCGTACCCATTTCATGTATATATATATATATATAAGCTAACCATCGAAATACTTAATTTTGTAGTGGTGTCATTGGATTTTTGCTATGTGCGAAGGA
Type
EST
SNP
PCR primers
BE488670B_F1 CACTATCTCCATTTTAGCAGGC
BE488670_cpR1 GACCTTCCTTCGCACATAGC
Sequence
NSFT03P2_Contig13943
Linkage Group
7A
Source Species
Triticum aestivum
Data Source
You, Frank Mingan2010.01