Query (optional)   in Class  

GrainGenes Probe Report: BE488921-3A

[ Printable Version ]  [ Submit comment/correction ]

Probe
BE488921-3A
Data at Wheat_SNP
BE488921-3A
Reference
ReferenceAkhunov ED et al. (2010) Nucleotide diversity maps reveal variation in diversity among wheat genomes and chromosomes. BMC Genomics 11:702.
General Remarks
SNP G>A at 179
Reference sequence CAGATCTTTTCCTGGTGGGATTGTTCTACCATCTCTATAATCAGGTAACCAGTTGCATAGGCTCTTGTTGGAATAATTAGGTGTGGCATTTGAGCTTTCTCATGGCATTACACCATACCATTTGTAATAACATGAGCCATACAATGACTTTACCGGCATCTGTTTCTTATGCAATGTAGAGATCAACATTTAGCAGCAGTTGATCGTGATGTTGCCAGACTAGCACATTCCATTTTTGATGGTTTCATCTGTTATAATCCGTTACATGGCTCATGGCAGATTGCTACAAACACTTTGGAACGGGTGGCCCCTCTGACACATGCTGTTGGCAATGTGTTGAAAAGGGTTTTCGTCATTGGTTTCTCGATCATCATTTTTGGTAAATAAAATGTCCCATTATTTATTATGACTAAATATTATTTGCCCAATTGTCCTTTTTTCTGTCGCATGGGTTTA
Type
EST
SNP
PCR primers
BE488921A_R1 TAGGCATAAACCCATGCGAC
BE488921A_R1 TGCTGTTGGCAATGTGTTAAA
BE488921_cpF1 TCAGATCTTTTCCTGGTGGGBE406587-3B
PCR_primers
Sequence
NSFT03P2_Contig16956
Linkage Group
3A
Source Species
Triticum aestivum
Data Source
You, Frank Mingan2010.01