Query (optional)   in Class  

GrainGenes Probe Report: BE488921-3B

[ Printable Version ]  [ Submit comment/correction ]

Probe
BE488921-3B
Data at Wheat_SNP
BE488921-3B
Reference
ReferenceAkhunov ED et al. (2010) Nucleotide diversity maps reveal variation in diversity among wheat genomes and chromosomes. BMC Genomics 11:702.
General Remarks
SNP C>T at 285
Reference sequence TTTTCAGATCTTTTCCTGGTGGGATTGTTCTACCATCTCTATAATCAGGTAACCAGTTGCATATGCTCTTGTTGGAATAATTAGGTGTGGCACTTGAGCTTTCTCATGGCATTACACCATACCATTTGTAATAACATGAGCCATACAATGACTTTACCGGCATCTGTTTCTTATGCAATGTAGAGATCAACATTTAGCAGCAGTTGATCGTGATGTTGCCAAACTAGTAGATTCCATTTTTGAATGGTTCATCAA
Reference sequence GCCATCCCTCACTGAACTGTCGTTTAGCTGGAAGGGTTTCATCAATGCTATGATCTCTAACATCTCATTCACTTACCGGAGTATTTATTCCAAGAAAGCCATGGTTTGTGCCTGTTTTCTTCTTATCGCTTGACTCCTCATATCTTTTGTTGCCTTTTGGGCTCTTTGTGGTTCAATTCCTTTGTTTTTACTAACCATTTTTGTCGTTGCAGACTGACATGGATAGCACCAACGTGTATGCTTACATCTCAATAATTGCTCTAGTTGTCTGCATACCGCCTGCACTTATTGTAAGTGTGATAAATATAGCCCAAATAAAAAAGGTTTCATGTGTTATGCTTCACGTTCACGTTTCTTATTTCGAATGACCAACCTTGCAGATTGAAGGACCACAGCTAATGCAGTATGGATTAAACGATGCAATTGCAAAAGTAGGAATGACAAAATTTGTATCAGATCTTTTCCTGGTGGGATTGTTCTACCATCTCTATAATCAGGTAACCAGTTGCATATGCTCTTGGAGGAATAATTAGGGGGGGGACTGGAGCTTTCTC
Type
EST
SNP
PCR primers
BE488921B_R4 ATGCCATGAGAAAGCTCCAG
BE488921_cpF1 TCAGATCTTTTCCTGGTGGG
Sequence
NSFT03P2_Contig16956
Linkage Group
3B
Source Species
Triticum aestivum
Data Source
You, Frank Mingan2010.01