Query (optional)   in Class  

GrainGenes Probe Report: BE489218-4A

[ Printable Version ]  [ Submit comment/correction ]

Probe
BE489218-4A
Data at Wheat_SNP
BE489218-4A
Reference
ReferenceAkhunov ED et al. (2010) Nucleotide diversity maps reveal variation in diversity among wheat genomes and chromosomes. BMC Genomics 11:702.
General Remarks
SNP C>T at 114
SNP DEL at 223
Reference sequence CTGCTCCTGGACCAGCATGTGGCCGTACTCCATGAGCTTCTCGATGGTCATCTTGGGCTGGTCGAACGTCGGCGGCCCCTCCCTGGAGTTGACGAGCCGCTTGGAGATGTTCTCGACGCCGATCTCGCCGACCCACTTGCGCACCTCGTCGTCGTACACCCGCGCCCGCAGCGCGCCGAAGAAGTCGATGGACTGCCCCGGGAAGGTGTCCACCAGCCTCACCACGGCCTCGTCGGGGACGTTGTCGGTGCGGAAGATGCCCTTGCACACGCCGATGCGGTCCTCCCGGGTGG
Type
EST
SNP
PCR primers
BE489218A_R1 TACTGGGCGCCCACCCGG
BE489218_cpF1 CTTCACGTTCTCCTGCTCCT
Sequence
NSFT03P2_Contig11577
Linkage Group
4A
Source Species
Triticum aestivum
Data Source
You, Frank Mingan2010.01