Query (optional)   in Class  

GrainGenes Probe Report: BE489326-3A

[ Printable Version ]  [ Submit comment/correction ]

Probe
BE489326-3A
Data at Wheat_SNP
BE489326-3A
Reference
ReferenceAkhunov ED et al. (2010) Nucleotide diversity maps reveal variation in diversity among wheat genomes and chromosomes. BMC Genomics 11:702.
General Remarks
SNP C>T at 337
Reference sequence AAGCACTGAGTTCCTTCAGCTGATTCTTAGTGGCAATGATGAAGGCTACAATACTTCAAGCGAACTACAAGTTTGGGATGTTCTGGACTTCTACTTCTCAGAAAGTTTTTCTGATGTACAATTTGATAGTATAATGGGTTTTACAAGTGATGTCAGTACTTCCTCTCATGATTATATGAATATTGCTGACTTGGTAGAGCGGCCTGTGGCACTCCTGTCTCTCAATGAGACAGAGGAACCAAATAATGCAGCCAATAAGGCTCTGGTCGACCACAGTAGAATGGACCCAGATGACACATCCTTGTACCTTCAAATGAAACCACCAGATTCAGAAATCGAAAGTACTTCTGCCTCTCAGGATGTGATAGGAATTGAGTATGTCGATTCAATTCCTAGAGGTCTACCTTCAAATGAAAAGCTTCATTCTAGAGGTCTGCCTGATTTAATGGATGTTGACTCATCCAATCGTCTACGAAAATCACCAGTGAGAACGAAGCATGTCACTCTTGTACTTGATTTGGATGGTAAGCAGGCGATGTGTTCACGTCATTCAATTATACTTCTGAAGTTTTCTTTCTTCTAGTAACTGTGACTTAGGAAGCAAAGTTCATAGATATTCAGACTACATCGGCTGTAATTAAACCATGGGGATTTGATTATGCTCTCCTATGATTAGGATTGTTTAAAGCATCCCCCCGC
Type
EST
SNP
PCR primers
BE489326A_R2 CTTGCGGGGATTGCTTTA
BE489326_cpF1 GCAATGGATGAAAGCACTGA
Sequence
NSFT03P2_Contig2857
Linkage Group
3A
Source Species
Triticum aestivum
Data Source
You, Frank Mingan2010.01