Query (optional)   in Class  

GrainGenes Probe Report: BE489326-3B

[ Printable Version ]  [ Submit comment/correction ]

Probe
BE489326-3B
Data at Wheat_SNP
BE489326-3B
Reference
ReferenceAkhunov ED et al. (2010) Nucleotide diversity maps reveal variation in diversity among wheat genomes and chromosomes. BMC Genomics 11:702.
General Remarks
SNP A>G at 300
SNP A>G;A>G;A>T at 559;560;561
Reference sequence TGTTGACTCATCGAGTCGTCTGCGAAAATCACCAGTGAGAACAAAGCATGTCACTCTTGTGCTTGATTTGGATGGTAAGCAGGCAGTGTATTCACATCATTCAGTTATACTTCTGAAGTTTTCTTTCTTCTAGTAATTGTGACTTAAGCATGATGCCATCCTGTCTGCTCAGGGATTTGTAAGACAAGTTTATAGATATTTTAGGAAGCAAAGTTCATAAATCTACCGACTACATCGGCTGGAATTAAACTGCAAGAAAATTGATGATCAACTATTAAATAATAACCTGTGGGGATTTGATTATGCTCTCCTAAGATTAGGATTGTTTAAATCAATCCCTGCAAGCCCCATCAATATGTTGGATAAAGTGGATCCAAATTTCTGTTTCCTTTGAAATCTTTGATCATCCAGTTCACAGTGAATGGTTTTCTTTTTCTTTGTGGTGTCATAAATTTTTCAGTTTTTTATTTTAGGTCATGCATTAGCTCATTATCTTCAGCATTGCAAAATTCAGTTGTGATGTCAACATTCTTACTGCGATTTCTATTTTCTAAAGATAAATTAACCATTTTTCATATGCAGAAACTCTTGTCCATTCA
Type
EST
SNP
PCR primers
BE489326B_F5 TTAATGGATGTTGACTCATCGAG
BE489326_cpR5 TCCAATGTTGAATGGACAAGAG
Sequence
NSFT03P2_Contig2857
Linkage Group
3B
Source Species
Triticum aestivum
Data Source
You, Frank Mingan2010.01