Query (optional)   in Class  

GrainGenes Probe Report: BE490130-6D

[ Printable Version ]  [ Submit comment/correction ]

Probe
BE490130-6D
Data at Wheat_SNP
BE490130-6D
Reference
ReferenceAkhunov ED et al. (2010) Nucleotide diversity maps reveal variation in diversity among wheat genomes and chromosomes. BMC Genomics 11:702.
General Remarks
SNP INS;T>A;G>A;A>C;DEL;INS at 267,1;383;447;536;546;668,2
SNP G>A at 58
Reference sequence GGGATGTACAGTCAATCAAGAAGGCTACAACTCGACATACTATTCTCTTTTCACGTAAAAGGAGCATTCTGCCATCAAAGAAACGAAGAGCAGATGATGCTGTCATGTCCGGTAGAGATAAAATGGCCAAAACTGGAGATGGCACCCAACCAGGCATGGGAACTGATCCAAATGCTCATAATCCTGCAGTTTGGCCTGCGACTTCTGAAGCATCAGCGCAGCAATGGGGGGCTGCTTACGCACAGCAGGTTGCTTATCTTCACGCTTACTATTTTATATGCATTATAGTTTGTCCATGAATAAGAGAAGTGAGATGTTGATTTGCCCAAGCTAATATCTCTAGTCCTCTACAAATCATCCCAATTATGGGCTGGTGGTTATTTATCATTGTTTGACTTTTAGGTCTATTTCTCTTCCCAAACGTGGAGCCCTTGACCATGTGGTCAGCGTGAAAAGCAGTTGATTTCTGCAACTCTTTTCTCTGGCCTGCTTCTATTGTTTAGATGTGCTTATTTGGTCAATCTTGTGGTTCATTACTATGCTATGTTTTTTTATCACATCTTTGAATTTTCATTATAGAGAATTTTTATTGTTACTTTTTCATCTATGATTTGTAGCTGTAGTCATTTCTCCAGTAATATGCCTGTTTTTGTATTTAACTTACTGTGCACTGCAGGCTGCTTATCCTGCATATGGAGCTTACGACTAC
Reference sequence GTTTGACTTTTAGGTCTATTTCTCTTCCCAAACGTGGAGCCCTTGACCATGTGGTCAGCGTGAAAAGCAGTTGATTTCTGCAACTCTTTTCTCTGGCCTGCTTCTATTGTTTAGATGTGCTTATTTGGTCAATCTTGTGGTTCATTACTATGCTATGTTTTTTTATCACATCTTTGAATTTTCATTATAGAGAATTTTTATTGTTACTTTTTCATCTATGATTTGTAGCTGTAGTCATTTCTCCAGTAATATGCC
Type
EST
SNP
PCR primers
BE490130_cpR1 GGGCATTTGTTGGCTGTAGT
BE490130D_F1 TGATTTGCCCAAGCTAAT
Sequence
NSFT03P2_Contig15173
Linkage Group
6D
Source Species
Triticum aestivum
Data Source
You, Frank Mingan2010.01