Query (optional)   in Class  

GrainGenes Probe Report: BE490147-6A

[ Printable Version ]  [ Submit comment/correction ]

Probe
BE490147-6A
Data at Wheat_SNP
BE490147-6A
Reference
ReferenceAkhunov ED et al. (2010) Nucleotide diversity maps reveal variation in diversity among wheat genomes and chromosomes. BMC Genomics 11:702.
General Remarks
SNP T>C;C>T at 292;426
SNP T>C at 292
Reference sequence CAGGAGGGTCACCAAGATGAAGATGATTTCGCCCTCCAACGTCGCCGTCGACATCGGCCGCACGCTCGCGCCGCACGAGTACATTGGCATGGTCAGGCGCGAGGTGCTCGACGACTTCCTCCGTAACCGCGCGCAGAAGGCCGGCGCCGAGGTCCTCAATGGCCTCTTCCTAAGGTATGCATACCACTTCGGCCGTCAAATGCAAGATTATGAGTACGCTAGGATTAGTTCTGCACTTCTCCTGCCATCGCGCTGGATGTTATCCTGACACTATATCACTGAGCACAAGTGTTTCAGTGTCAGAGTGCACGTAGTAGTAGTAGCATTACATTTGCATGATGAACTTAGCACGAGAGAGACGAGACGCTGTCTGTGTGACTTCATCTTCGTCGACTATTGTATTTGGCCTTGTTGACGTATATGTGCTGCCTAGTCTC
Type
EST
SNP
PCR primers
BE490147A_R3_UCD CTTATGAAAGAGACTAGGCAGC
Sequence
NSFT03P2_Contig18289
Linkage Group
6A
Source Species
Triticum aestivum
Data Source
You, Frank Mingan2010.01