Query (optional)   in Class  

GrainGenes Probe Report: BE490153-4B

[ Printable Version ]  [ Submit comment/correction ]

Probe
BE490153-4B
Data at Wheat_SNP
BE490153-4B
Reference
ReferenceAkhunov ED et al. (2010) Nucleotide diversity maps reveal variation in diversity among wheat genomes and chromosomes. BMC Genomics 11:702.
General Remarks
SNP A>G at 161
Reference sequence CCTGTACCTCCTTAAGGCCAACTCTCAACCCTCCAAAGGGTCCGGCGCCCCTGCCTGGCTCTACGGCGTCGTCTTCGGATGTGTCGCCTTTGTACTGCTAGTTGCTGCCGCTGCTGGTTCGTGCTTCTTCGTGTGGCGACGCCGGAGGCGGGCTGCCGCTACCGCACTAGCCGCTGACAGCAGGAGCAAGCGCTCGCATGCAATGGAGTCCATCACCGCCAGCACCACCCTGCTCAAGTTCACCTACGACGACATCAAGATGGCCACGGGGAGCTTCGCTAGAGACAGCATCATCGGCCGCGGTGGTTTCGGGAATGTGTACAAGGGGGTGCTCCCCGATGGCGCAGAGGTGGCAGTGAAGCGTTTCAAGAACTGCTCGGCGGCCGGGGATGCGGCGTTCGCACATGAGGTGGAGGTGGTGGCCAGCGTGCGCCATGTCA
Type
EST
SNP
PCR primers
BE490153B_F1 GGACACAGCGGACTGCCTG
BE490153_cpR2 agcgcgaccaggttgacatg
Sequence
unknown
Linkage Group
4B
Source Species
Triticum aestivum
Data Source
You, Frank Mingan2010.01