Query (optional)   in Class  

GrainGenes Probe Report: BE490153-4D

[ Printable Version ]  [ Submit comment/correction ]

Probe
BE490153-4D
Data at Wheat_SNP
BE490153-4D
Reference
ReferenceAkhunov ED et al. (2010) Nucleotide diversity maps reveal variation in diversity among wheat genomes and chromosomes. BMC Genomics 11:702.
General Remarks
SNP T>C;T>C at 113;416
SNP T>C at 113
Reference sequence TCGACGCCCGAGTGCCTGCCTCCGCCCGCAGGGACATCAACGCCAGCTGCTACCGCGAGCTCGGCGCCGTTCCGGTCTGCACCACCTGCACGACCTCGCTCAGCAAGACGGCTGCAGCCTACCTCCTACCTGGATCCCCCGACGGGGGAAACAATGTCACCGGCTGCGTCCAGTACCCCTTCATATACACCGGCGCCGCGGCCAGCCTACGCGGCCCCGACGACCCGGACACAGCCAACTGCCTCTACCTCCTTAAGGCCAACTCTGAACCCTCCAAAGGGTCCGGCGCCCCTGCCTGGCTCTACGGCGTCGTCTTCGGATGTGTCGCCTTTGTACTGCTAGTTGCCGCCGCGGCTGGTTCGTGCTTCTTTGTGCGGCGACGCCGGAGGCGGGCTGCCGCTGCCGCACTGGCTGCTGACAGTAGGAGCAAGCGCTCGCATGCCATGGAGTCCATCACCGCCAGCACCACCTTGCTCAAGTTCACCTACGACGACATCAAGATGGCCACGGGGAGCTTTGCTAGAGACA
Type
EST
SNP
PCR primers
BE490153_cpR1 cggccgatgatgctgtctcta
BE490153D_F1 CCACGCGAGCGGATTTCGAC
Sequence
unknown
Linkage Group
4D
Source Species
Triticum aestivum
Data Source
You, Frank Mingan2010.01