Query (optional)   in Class  

GrainGenes Probe Report: BE490177-4B

[ Printable Version ]  [ Submit comment/correction ]

Probe
BE490177-4B
Data at Wheat_SNP
BE490177-4B
Reference
ReferenceAkhunov ED et al. (2010) Nucleotide diversity maps reveal variation in diversity among wheat genomes and chromosomes. BMC Genomics 11:702.
General Remarks
SNP T>A;G>A;C>T;A>C at 70;109;127;484
Reference sequence ATCCTGAGCTATCAGACAGACACAAACCACTGTTGTAATAGATGTGAGGAACTGACCTTTACCAGCTCATGCTATGTATTTTATCTCCTGCATACGTCAAAAATAAAAGGACAGACTGCAATACTACGAGCCCTGTTTGGCAAAGCCCGTCAGGCAGTCACCAATGCACTGATTATAGACTATAGAGTTTAACAAAGTTTTGCTCCTCACTAGCCTGTTGTCTTAATTCTTACCGTCATTCAGTATTGACAAATTTAATTTACAATTTGAATAGGTTATTAACTTTTATATTGCTTAATCAGGCATAAGGTTGGGATTTGCTACCTCTGTATCTCTGATTTTGTTATAATTTGTACACTTAACCTATTATTTTGCAAATGTTCTCCTGATTTTCTGTAATGGCGCTAGTGCGATACAGATCTCACTGCTGCCAGTATAGAGGACATGTTAAATCAAATGTCCCTTTTGTTAAATTAGATACTTATGATCCCAGGATACATATTTCTCGTAGCATAGTTTCTTCCATGTACCCAATATCCAGTAGTGGCCCTGAAGGCAACATTTCGTGCATTCACTCACAGTTTGACCCTCTACTTTTTCCACATTACTGTGGAAAAGAATATTCATTAGTTTGCACTATGTGGATGTTGTCTCACTTCCCTTGTATGTTGAACTGCTCTTGAATTGCCTTTCTTAATGTAGTTTGCTAAATCCTGTGATTTGATGCTAGGTCGACGTCTGTTTTCAGTGTACTTGAAAATCCTGCAGGTGTTCAAATGGTAGCTTTATCATAGATGCTTAGCAAATTGTTGTTGTAGAACA
Type
EST
SNP
PCR primers
BE490177B_F1 TTTTGTGGTATTCTTCTATCTTG
BE490177_cpR1 GGGCAACAATAAGCTCGGTA
Sequence
NSFT03P2_Contig11354
Linkage Group
4B
Source Species
Triticum aestivum
Data Source
You, Frank Mingan2010.01