Query (optional)   in Class  

GrainGenes Probe Report: BE490219-7D

[ Printable Version ]  [ Submit comment/correction ]

Probe
BE490219-7D
Data at Wheat_SNP
BE490219-7D
Reference
ReferenceAkhunov ED et al. (2010) Nucleotide diversity maps reveal variation in diversity among wheat genomes and chromosomes. BMC Genomics 11:702.
General Remarks
SNP DEL at 248-251
SNP DEL;T>C at 70-71;698
Reference sequence GTCAAATCTCTCATCTTGTTTTGGAGCTGCTTGATTTCCCTGAATTGCTAGTAAGAAAGCTGAAACATAGTGTTGCATTTACATTACCTTTCCTTTCAGCAGTGAAGGAGAAAACGTTGCATCTTGAAATGTGGATGGTTTTATGGAGTTATGTTAACGCGCAGCTTAGCATCTATGAACAATGTCCACCAATTTCCTCACTAGGTGCAGCATGTCAAAATTTTAGTCTACTGCTGCATCCAGAATACAATACCACCATATGAGATAGTACTTGGTAGATGATCGATAATGTGTGGCTGTGACACAGTAAATTTTGGAACACTAATCTGCTGCATTAGCCAGTAGGTATGTGATTGCCTTCCGGCTTGACTTAAATTGCATGCTGTATATCATGAAATGCGGAAGTAGTAATAACATTGTAAGCTTCTGCAAGCCTTTCGTTTTCTGAATGAATTGAAGTAGCCACACCCTGAGCTTGAAATCTTGTACCCTATTATTTTTCCTATCTAAATTGTGTCAGATATTACTGGACTTCAAAATGAGGATGGATCATTTTCTGGTGATATTTGGGGTGAAGTTGATACTAGGTAAACACCTTAGCTGTTCTTTTTGAGTTACCCATGTGTTTTATTTGAATGCAGCATCTGTGTGGGCTACTAATATGAATGTGATATATATCTTGTAGGTTCTCGTATATTTCCATATGCACCTTGTCATTACTGCATCGTCTGCACAAAATTAATG
Type
EST
SNP
PCR primers
BE490219D_F1 TGCTCCTGCTGTAGCAGTTABE590476-7D
PCR_primers
BE490219_cpR1 GCCGTCCAAGTTCTTACAGC
BE490219D_F1 CCTGCTGTAGCAGTTAGCG
Sequence
NSFT03P2_Contig9303
Linkage Group
7D
Source Species
Triticum aestivum
Data Source
You, Frank Mingan2010.01