Query (optional)   in Class  

GrainGenes Probe Report: BE490267-2B

[ Printable Version ]  [ Submit comment/correction ]

Probe
BE490267-2B
Data at Wheat_SNP
BE490267-2B
Reference
ReferenceAkhunov ED et al. (2010) Nucleotide diversity maps reveal variation in diversity among wheat genomes and chromosomes. BMC Genomics 11:702.
General Remarks
SNP C>T at 87
SNP G>A at 175
Reference sequence TTCCACGACTTCCTGCTCCTGTACGCGGCGAACGCCCGCAGGTAGTGCTTCTGGGCGTCCCCCAGCCTAGCGTCCTCGCCCAGATCCGGCTGGTCCGCGCCCCAGAACCGCGCCGCTCGCCGCTTCCGCCGGACGGCGGCCAGCACGTCGTTCCGGTTGCAGATCCCCCACACCGTCACCTTCTGCTGGTGGTAATCCACCTGAACCGAGTGAATCCCTGCAAGTAGCAGCAAGCTTAGTATTCATGCATGGCCGCCTCAACGTACCCATTGCTCAGGCAGGTTCCCGTAGAAATGTCCT
Type
EST
SNP
PCR primers
BE490267B_R2 TAGGACATTTCTACGGGAACCT
BE490267_cpF1 TTCTTCCACGACTTCCTGCT
Sequence
NSFT03P2_Contig2305
Linkage Group
2B
Source Species
Triticum aestivum
Data Source
You, Frank Mingan2010.01