Query (optional)   in Class  

GrainGenes Probe Report: BE490599-4D

[ Printable Version ]  [ Submit comment/correction ]

Probe
BE490599-4D
Data at Wheat_SNP
BE490599-4D
Reference
ReferenceAkhunov ED et al. (2010) Nucleotide diversity maps reveal variation in diversity among wheat genomes and chromosomes. BMC Genomics 11:702.
General Remarks
SNP G>C;C>A;A>T;C>T at 8;9;10;286
SNP C>T;INS at 289;328,8
SNP INS at 328,8
Reference sequence ACTTCTGGCAGTCAGCCAAATTAGTCATGACCGTGTCGCAGATATCTCGACAGTTCTTCAACCAGGAGATACCCTCAAGGTAATGCCGCCATCTTGTAAATCATGTAAATTTGCTGTTTCTATAGCTAAGGCTGGAGGACTTTCTTTGTTATCAGGTTATGATACTAAGCCATGACCGTGAAAGGGGCCGGGTTAGCCTTTCTACCAAGAAGCTTGAGCCAACGCCTGGTGACATGATTCGTAACCCGAAGCTGGTTTTCGAAAAGGTAAGTAATGCGGGCAATACCTTTTCACCAGAATATGTCGTTACAGACAAACTGACATGCTGGTTTACTATGCCCAAATTAGGCTGATGAAATGGCGCAGATATTCAGGCAGAGAATAGCTCAAGCAGAGGCAATGGCTCGTGCTGACATGTTA
Reference sequence CTGACTTCTGCATGTCAGCCAAATTAGTCATGACCGTGTCGCAGATATCTCGACAGTTCTTCAACCAGGAGATACCCTCAAGGTAATGCCGCCATCTTGTAAATCATGTAAATTTGCTGTTTCTATAGCTAAGGCTGGAGGACTTTCTTTGTTATCAGGTTATGATACTAAGCCATGACCGTGAAAGGGGCCGGGTTAGCCTTTCTACCAAGAAGCTTGAGCCAACGCCTGGTGACATGATTCGTAACCCGAAGCTGGTTTTCGAAAAGGTAAGTAATGCGGGCAATACCTTTTCACCAGAATATGTCGTTACAGACAAACTGACATGCTATGCCCAAATTAGGCTGATGAAATGGCGCAGATATTCAGGCA
Type
EST
SNP
PCR primers
BE490599_cpF1 GACTTCTGCATGTCAGCCAA
BE490599D_R1 GCCTGAATATCTGCGCCATT
Sequence
NSFT03P2_Contig18437
Linkage Group
4D
Source Species
Triticum aestivum
Data Source
You, Frank Mingan2010.01