Query (optional)   in Class  

GrainGenes Probe Report: BE490604-6A

[ Printable Version ]  [ Submit comment/correction ]

Probe
BE490604-6A
Data at Wheat_SNP
BE490604-6A
Reference
ReferenceAkhunov ED et al. (2010) Nucleotide diversity maps reveal variation in diversity among wheat genomes and chromosomes. BMC Genomics 11:702.
General Remarks
SNP G>A at 190
Reference sequence GTGCTTTGGGTCGATACAAACTGCTGGTGTAAACGGGCGGTATGGCATTGGAAAGAACAGTACATTCATATCTATCTACACCTTTTGGCTTTTCATTTCACATCTTCTAATGATATAACCAATGTCTATGCAGGCCGTGCTGCCATGGTGGGCTTCTTCATGGCTTACTTTGTCGATAGCTTGACGGGCGTGGGGCTCGTCGACCAAATGGGCAACTTCTTCTGCAAAACCCTGCTGTTTGTTGCTGTGGCTGGGGTGCTGCTGGTCAGGAAAAACGAGGACATCGACAATCTGAAGAAGCTCATCGACGAGTCGACATT
Type
EST
SNP
PCR primers
BE490604A_F2_UCD TAAATAACAGAATTATGTGCTTTGGG
BE490604_cpR1_UCD CTGCCATTGCTTGTCGTAGA
Sequence
NSFT03P2_Contig15784
Linkage Group
6A
Source Species
Triticum aestivum
Data Source
You, Frank Mingan2010.01