Query (optional)   in Class  

GrainGenes Probe Report: BE490786-6D

[ Printable Version ]  [ Submit comment/correction ]

Probe
BE490786-6D
Data at Wheat_SNP
BE490786-6D
Reference
ReferenceAkhunov ED et al. (2010) Nucleotide diversity maps reveal variation in diversity among wheat genomes and chromosomes. BMC Genomics 11:702.
General Remarks
SNP G>A at 72
SNP G>A;G>A;A>G at 72;489;595
Reference sequence CTGGGTAATGTATGATACAACAATACACCAAACCTTCTTCAGTTTCGTTGCTCCTTATCAAATGAGATCATGGTGTCACCTTATTCTTTTCTATCCTGTTTCTTCAAGATTTTCTTCTTGACTGGAGTAGGCCTTCTTCTCGGTTGGCAATCTATGTGGCAGCTATTTACAAAGAAGGCAAACATTAAGGTACTCAACATTTGGATAGATACATGGCGCTATCCTTTTGCTTCTTCATACTTAAAATTGTAATCGGGTAAAGTGTGATGCTACATTATATTATTATTTATCCGTTGCTTACTGAAGTTAGATTTGTTTTCTTGCATGTGTACATAACATATCACATTCTTTCAGACAACTATATTCATCGAGCAAAATTTGAATGTTTCTCGGTGACAGTACAATATCATGTTGCTCTTTATTAGTCTTGTCCTTTCAATGCAATATCATGTTGCTCTTTATTAGTCTCGTTCATTCAATGCAATATCGTGGTGCTCTTTATTTGTCTTGTTCATTTATCAGTGGAATGCTGACCACATTGGTGTCTCTCCCAGTTCCATGTGTTAAATAGGTCATGCTATTTTTTCTGCAGGGATCTGTACCTTTCTTCCTTGGTCTCTTTCTTCTATTTGTCAGATGGCCTGTTGCTGGTATAATCCTGGAACTGTATGGATCTTTTGTCCTCTTCAGGTCATCACCTACATCAAACCATTTCTCTAATATCCTTTTCTTGGTGA
Type
EST
SNP
PCR primers
BE490786_cpF1_UCD GGTTTGTTGGCTCTGGGTAA
BE490786D_R2_UCD AAAGTCAGTATCAACCAAGAAAAGG
Sequence
NSFT03P2_Contig15568
Linkage Group
6D
Source Species
Triticum aestivum
Data Source
You, Frank Mingan2010.01