Query (optional)   in Class  

GrainGenes Probe Report: BE490825-5,4,6B

[ Printable Version ]  [ Submit comment/correction ]

Probe
BE490825-5,4,6B
Data at Wheat_SNP
BE490825-5,4,6B
Reference
ReferenceAkhunov ED et al. (2010) Nucleotide diversity maps reveal variation in diversity among wheat genomes and chromosomes. BMC Genomics 11:702.
General Remarks
SNP INS;T>C;A>T;C>G;C>G;G>T at 664,1;785;791;805;1059;1199
Reference sequence ATATCCATCACTAAAAGTAAGTCTACTTGTGATGACTGCATTAGTGCAATACATATCTTTCCTTATGTTTTGTTCCTTGTTGTTTTTCATTCTAAAAATAACCTCTGCTAACCCATCACTGTTAAACTCATATTTTTCTTTGCCATACATAAAACTGCCTGAAACTTGTATAAGGACATATATTACAGATTGCTATTTTGAAGGGATGTTGTTTCATGTCCCTTATGTACCAAGCAGTATTCTTGCAAAAAAATATATTCTTATTTAAAACCCATCCACAGTTAGTACAAAGTTGAGTCATCTATTTTGGAACGGAGGGAGTACTTTAGTAATATGTACTGCTTTATTAATTTTACAAGCCATTTTTATTAGAGACTCTTCTCAGTTAATTTAGGGCTTAACAATAGTGAATGCTTTTCAGGTTGTTAACTTCAGAGGAAATGTTCAGACACGGTTAAGGAAACTTAAAGAAGGAGATGTACATGCTACATTGTTGGCACTGGCTGGACTAAAACGGTTAGACATGCCAGAAACTGCAACATCTGTATTATCAGTAGACGAAATGCTTCCAGCAGTCGCTCAAGGCGCTATTGGAATAACTTGCAGGAGCAATGATGATAAAATGGTAGGTCATCTAATGTTTCAATCTGCTAGCAGAGTAAAATCTTAGATGCTACATGCATGCATAATACCATACCCAAATGTGGTACCAGCTGTGCTATGCCACTATGTTTTAATTCTTCAATTTTGCATGTGCCTCTGATAAATTGATAGGTTCAAGTGTTTATTTAGTGGTCTTTAGTGCCCATTGTACCACATCATGTTCTTACGGTCTTACCAAGATGCAGTTGTGTCCAATTCTGCATTGTCGACCAACTCTTTATATTTCACATCTTTATTAGCCATTTTGCCTAGCTTGCCTCCAATCCTTTTGTTTGTTGATTTTTTACCACACCATATTGAATATTTTAGTTCTCGAAATTGCTCAGAGAGCATGGAGTTAGAACATTCTGATTTCCTATTGCATACTGTTGTTTCATTCTGTGTTGTGCGTAGGTCCCCTGAGTTTCATTCTGTGTTGTGCGCAGAACACACCAGCCAATTGCCTGAGTTTTTATTTTGTTTACACCATCTACTTAAAGATGCTGATCCCTCCCTCTTTCCATTTTTTTGTGTGTAGATGGAGTATCTGTCCTCTGTGAATCATGAAGAA
Type
EST
SNP
Sequence
NSFT03P2_Contig18148
Source Species
Triticum aestivum
Data Source
You, Frank Mingan2010.01