Query (optional)   in Class  

GrainGenes Probe Report: BE490825-5,4,6D

[ Printable Version ]  [ Submit comment/correction ]

Probe
BE490825-5,4,6D
Data at Wheat_SNP
BE490825-5,4,6D
Reference
ReferenceAkhunov ED et al. (2010) Nucleotide diversity maps reveal variation in diversity among wheat genomes and chromosomes. BMC Genomics 11:702.
General Remarks
SNP T>A;INS;A>G;T>C;C>G;C>A;DEL;G>T;T>G at 262;267,1;617;883;1062;1133;1136;1210;1211
Reference sequence ATTCTCTATAATATCCATCACTAAAAGTAAGTCTACTTGTGATGACTGCATTAGTGCAATACATATCTTTCCTTATGTTTTGTTCCTTGTTGTTTTTCATTCTAAAAATAATCTCTGCTAACCCATCACTGTTAAACTCATATTTTTCTTTTCCATACATAAAACTGCCTGAAACTTGTATAAGGACATATATCACAGATTGCTATTTTGAAGGGATGTTGTTTCATGTTCCTTATGTGCCAAGCAGTATTCTTGCAAAAATAATAATATTTAAAACCCATCCAATCCCGCTATAAATCAGTCTTCTACTTTAGTAATATGTACTGCTTTATTATTTTACAAGCCATTTTTATTAGTGACTCTTCTCGGTTAATTTAGGGCTTAACAATAGTGAATGCTTTTCAGGTTGTTAACTTCAGAGGAAATGTTCAGACACGGTTAAGGAAACTTAAAGAAGGAGACGTACATGCTACATTGTTGGCACTGGCTGGACTAAAACGGTTAGGCATGCCAGAAACTGCAACATCTGTATTATCAGTAGACGAAATGCTTCCAGCAGTCGCTCAGGGCGCTATTGGAATAACTTGCAGGAGCAATGATGATAAAATGGTAGGTCATCTAATGTTTCAATCTGCTAGCAGAGTAAAAATCTTAGATGTTGCATGCATGCATAATGCCATACCCAAATGTGGTACCAGCTGTGTTATGCCACTATGTTTTAATTCTTCAATTTTGCATGTGCCTCTGATAAATTGATAGGTTCAAGTGTCTATTTTGTGGTCTTTATTGGCCATTGTACCACATCATGTTCTTACCAAGATGCAGTTGTGTCCAATTCTGCATTATCGACCAACTCTTCATATTTCACATCTTTATTAGCCATTTTGCCTAGCTTGCCTCCAATCCTTTTTTGTTGTTGATTTTTTACCACACCATATTGAATATTTTAGTTTTCGAAATTACTCAAGAGAGCATGGAGTTAGAACATTCTGATTTCCTATTGCATACTGTTGTTTCATTCTGTGTTGTGCGTAGGTGCCCTGAGTTTCATTCTGTGTTGTCCGCAGAACACACCAGCCAATTGCCTGAGTTTTTCTTTTGTTTACACCATCTAGTTAAAGATGCTGATCCCCCCCTCTTTCCATTTTTTTGTGTGTAGATGGAGTATCTGTCCTCTTTGAATCATGAAGATACCAGATTAGCTGTGCAGTGAAAGAGAATC
Type
EST
SNP
Sequence
NSFT03P2_Contig18148
Source Species
Triticum aestivum
Data Source
You, Frank Mingan2010.01