Query (optional)   in Class  

GrainGenes Probe Report: BE494023-4A

[ Printable Version ]  [ Submit comment/correction ]

Probe
BE494023-4A
Data at Wheat_SNP
BE494023-4A
Reference
ReferenceAkhunov ED et al. (2010) Nucleotide diversity maps reveal variation in diversity among wheat genomes and chromosomes. BMC Genomics 11:702.
General Remarks
SNP G>T at 763
SNP G>T;C>T at 31;405
SNP G>C;C>A;T>G;G>A;T>C;A>G;DEL at 6;44;184;282;380;450;788-790
Reference sequence AATCTGTCGTGTTCTATTGCTCATTTATAACCGACCTCCATAACACTATGAAGATTAACTTGCAATCTGCATCTGTGGTAGCATAAGAAATACCAACTACTCAGCAAAGTGGCATTGCAGGGAACCTAGATGATACAATTATTCTTTTTTATCTTAGCACAATCTTGCAAGCATTGAACATCATACGAACACGCTTCCCTGCTACTGCCATAGTTTTAAGCTGTCACTGTAATTCATTCTTTGTTGGTAAGTTAATTGAAATATGGTGTGCCATTATCCTCGGGCTTGATTGTTCCATGATACAATAGGAAATCGTGTCTTCATGCACACAGCATTAATTCAGTCATGTTGATTTATCTATTTCAGACACAAAGTTTTATGTTGATGTCTCCTGAATAGGATAAGCCAATTTTGTGATGGGAATCTTAAATTTGTAGGTCATAGGATGTATGTCTGCCACTTAAGTTTTTTTCTGTGTTAAATTGTTCATATTTTAGGCAATAGGCTTTGCAAGTTAACAGAACGTGTTTTGATTTGATGGACATTGTTCTCAGGGAGCTGTAAAAGTTATGGCCAAGGACCTTATTCGCACAAGGCATCAGATCACGAAATTTTATGCCCTGAAGTCCCAGTTGCAAGGTGTATCTCTTCGTATTCAGGTAGCGTTGTAATCCAAGCAGACGCTGTATATTTCATACATTTAGATATGTGCACATTCTACAATGTGATGAGGTCAAGCGACAGTAGGCTTCATTATATTGTGGAAACTCTGTTTTTCTCATTGCTGCTGACGTTCGCGTGCTAAATTTTTATAGACCCTGAAATCAACACAAGCAATGGGAGAAGCCATGAAGGGCGTCACAAAAGCCATGTCACAGATGAACAGGCAGATGAATCTACCAGCACT
Reference sequence TTTTTATCTTAGCACAATCTTGCAAGCATTGAACATCATACGAACACGCTTCCCTGCTACTGCCATAGTTTTAAGCTGTCACTGTAATTCATTCTTTGTTGGTAAGTTAATTGAAATATGGTGTGCCATTATCCTCGGGCTTGATTGTTCCATGATACAATAGGAAATCGTGTCTTCATGCACACAGCATTAATTCAGTCATGTTGATTTATCTATTTCAGACACAAAGTTTTACGTTGATGTCTCCTGAATAGGATAAGCCAATTTTGTGATGGGAATCTTAAATTTGTAGGTCATAGGATGTGTGTCTGCCACTTAAGTTTTTTTCTGTGTTAAATTGTTCATATTTTAGGCAATAGGCTTTGCAAGTTAACAGAACGTGTTTTGATTTGATGGACATTGTTCTCAGGGAGCTGTAAAAGTTATGGCCAAGGACCTTATTCGCACAAGGCATCAGATCACGAAATTTTATGCCCTGAAGTCCCAGTTGCAAGGTGTATCTCTTCGTATTCAGGTAGCGTTGTAATCCAAGCAGACGCTGTATATTTCATACATTTAGATATGTGCACATTCTACAATGTGATGAGGTCAAGCGACAGTAGGCTTCATTATATTGTGGAAACTCTGTTTTTCTCATTGCTGACGTTCGCGTGCTAAATTTTTATAGACCCTGAAATCAACACAAGCAATGGGAGAAGCCATGAAGGGCGTCACAAAAGCCATGTCACAGATGAACAGGCAGATGAATCTACCAGCACTCCAGAAGATAATGCG
Type
EST
SNP
PCR primers
BE494023A_F1 CCAACTACTCGGCAAAGTGG
BE494023_cpR1 CCATAACCTCGCTGACCATT
Sequence
unknown
Linkage Group
4A
Source Species
Triticum aestivum
Data Source
You, Frank Mingan2010.01