Query (optional)   in Class  

GrainGenes Probe Report: BE494023-4B

[ Printable Version ]  [ Submit comment/correction ]

Probe
BE494023-4B
Data at Wheat_SNP
BE494023-4B
Reference
ReferenceAkhunov ED et al. (2010) Nucleotide diversity maps reveal variation in diversity among wheat genomes and chromosomes. BMC Genomics 11:702.
General Remarks
SNP DEL at 653
Reference sequence TATTACTCGTTTATAATCGACCTCCATAAAACTATGAAGATTAACTTGCAATCTGCATCTGTGGTAGCATAAGAAATACCAACTTTGTCAGCAAAGTGACGTTGCAGGGTACCTAGATGATACGATTATTCTTTTTTATCTCAGCACAATCTTGCAAGCATTAAGATCATAAGAACAGCAACCATTCTTCCCTGCTACTGCCATAGTTTTAAGCTGTCACTGCCATAGTTAATTGAAATATGGCGTGCTATTATCCTCGCACTTGATTGTTCCATGATACAATAGGAAATGGTGTCTTCATGCACATATGAATTAATTCAGTCATGTTGATTTATCTATTCCAGTCACAAAGTTTTATGTTGATGTCTCCTGAATAGGGTAAGCCAATTTTGTGTTTGGAATCTTAAATTTGTAGGTCATAGGGTGTGTGTCTGCCACTTAAGTTTTTTCTGCGTGCAAGTGCTCATATTTTAGGCAATAGGCTTTGCAAGTTAATGGAACATGCTTTGATTTTATTGACGTTGTTCTCAGGGAGCTGTGAAAGTTATGGCAAAGGACCTTATTCGCACAAGGCATCAGATCACGAAATTTTATGCCCTGAAGTCCCAGTTGCAAGGTGTATCTCTTCGTATTCAGGTAGCATTGTAATCCAAGCAGATGCTGTA
Reference sequence TTTATCTCAGCACAATCTTGCAAGCATTAAGATCATAAGAACAGCAACCATTCTTCCCTGCTACTGCCATAGTTTTAAGCTGTCACTGCCATAGTTAATTGAAATATGGCGTGCTATTATCCTCGCACTTGATTGTTCCATGATACAATAGGAAATGGTGTCTTCATGCACATATGAATTAATTCAGTCATGTTGATTTATCTATTCCAGTCACAAAGTTTTATGTTGATGTCTCCTGAATAGGGTAAGCCAATTTTGTGTTTGGAATCTTAAATTTGTAGGTCATAGGGTGTGTGTCTGCCACTTAAGTTTTTTCTGCGTGCAAGTGCTCATATTTTAGGCAATAGGCTTTGCAAGTTAATGGAACGTGCTTTGATTTTATGGACGTTGTTCTCAGGGAGCTGTGAAAGTTATGGCAAAGGACCTTATTCGCACAAGGCATCAGATCACGAAATTTTATGCCCTGAAGTCCCAGTTGCAAGGTGTATCTCTTCGTATTCAGGTAGCATTGTAATCCAAGCAGATGTTGTATATTTCATACATTTAGATATGTGCACATTCTGCAATGTGATGAGGTCAGGCTTCATTATATTGTGGAAGCTCTGTTTTTTCTCATTTGCTTAAGTTTGCGTGCTAAAATTTTATAGACCCTGAAATCAACACAAGCAATGGGGGAAGCCATGAAGGGCGTCACAAAAGCCATGTCACAGATGAACAGGCAGATGAATCTACCGGCACTGCAGAAGATAATGCG
Type
EST
SNP
Sequence
unknown
Source Species
Triticum aestivum
Data Source
You, Frank Mingan2010.01