Query (optional)   in Class  

GrainGenes Probe Report: BE494023-4D

[ Printable Version ]  [ Submit comment/correction ]

Probe
BE494023-4D
Data at Wheat_SNP
BE494023-4D
Reference
ReferenceAkhunov ED et al. (2010) Nucleotide diversity maps reveal variation in diversity among wheat genomes and chromosomes. BMC Genomics 11:702.
General Remarks
SNP A>G;T>C;G>T;A>C;G>A;DEL at 70;195;440;572;575;698-699
SNP T>C;G>T;A>C;G>A;DEL at 194;439;571;574;697-698
Reference sequence ATCTCTCGTGTTCTATTGCTCATTTATAATCGACCTCCATAAAACTATGAAGATTAACTTGCAATCTGCATCTGTGGTAGCATAAGAAATACCAACTTCTCAGCAAAGTGACATTGCAGGGAACCTAGATGATACAATTATTCTTTTTTATCTTAGCACAATCTTGCAAGCATTGAAGATCATACGAACACCAATCATTCTTCCACTGTAATTCATTCTTTGTTGGTAAGTTAATTGAAATATGGTGTGTCATTATCCTCGGCCTTGATTGTTCCATGATACAATAGGAAATGGTGTCTTCATGCACACAGCATTAATTCAGTCATGTTGATTTATCTATTTCAGACACAAAGTCTTACGTTGATGTCTCCTGAATAGGATAAGCCAATTTTGTGTTGGGAATCTTAAATTTGTAGGTCATAGGATGTGTGTCTGCCACGTAAGTTTTTTTCTATGTTAAATTGTTCATATTTTAGGCAATAGGCTTTGCAAGTTGACGGAACGTGTTTTGATTTGATGGACGTTGTTCTCAGGGAGCTGTAAAAGTTATGGCAAAGGACCTTATTCGCACAAGGCATCAGATCACGAAATTTTATGCCCTGAAGTCCCAGTTGCAAGGTGTATCTCTCCGTATCCAGGTAGCATTGTAATCCAAGCAGACGCTGTATATTTCATACATTTAGATATGTGCACATTCTACAATGTGATGAGGTCAAGCACAGTAGGCTTCATATATTGTGAAGCTCTGTTTTCTCATGCTGAGTTGCGTGCTAATTTTATGACCTGAATCTACCAGCATGGGG
Reference sequence TCTCTCGTGTTCTATTGCTCATTTATAATCGACCTCCATAAAACTATGAAGATTAACTTGCAATCTGCATCTGTGGTAGCATAAGAAATACCAACTTCTCAGCAAAGTGACATTGCAGGGAACCTAGATGATACAATTATTCTTTTTTATCTTAGCACAATCTTGCAAGCATTGAAGATCATACGAACACCAATCATTCTTCCACTGTAATTCATTCTTTGTTGGTAAGTTAATTGAAATATGGTGTGTCATTATCCTCGGCCTTGATTGTTCCATGATACAATAGGAAATGGTGTCTTCATGCACACAGCATTAATTCAGTCATGTTGATTTATCTATTTCAGACACAAAGTCTTACGTTGATGTCTCCTGAATAGGATAAGCCAATTTTGTGTTGGGAATCTTAAATTTGTAGGTCATAGGATGTGTGTCTGCCACGTAAGTTTTTTTCTATGTTAAATTGTTCATATTTTAGGCAATAGGCTTTGCAAGTTGACGGAACGTGTTTTGATTTGATGGACGTTGTTCTCAGGGAGCTGTAAAAGTTATGGCAAAGGACCTTATTCGCACAAGGCATCAGATCACGAAATTTTATGCCCTGAAGTCCCAGTTGCAAGGTGTATCTCTCCGTATCCAGGTAGCATTGTAATCCAAGCAGACGCTGTATATTTCATACATTTAGATATGTGCACATTCTACAATGTGATGAGGTCAAGCAACAGTAGGCTTCATTATATTGTGGAAGCTCTGTTTTTCTCATTGCTG
Type
EST
SNP
PCR primers
BE494023_cpF1 GCTGAGATCAAGAAGGTGGC
BE494023D_R1 TTCCCCCATTGCTTGGGTA
Sequence
unknown
Linkage Group
4D
Source Species
Triticum aestivum
Data Source
You, Frank Mingan2010.01