Query (optional)   in Class  

GrainGenes Probe Report: BE494426-5A

[ Printable Version ]  [ Submit comment/correction ]

Probe
BE494426-5A
Data at Wheat_SNP
BE494426-5A
Reference
ReferenceAkhunov ED et al. (2010) Nucleotide diversity maps reveal variation in diversity among wheat genomes and chromosomes. BMC Genomics 11:702.
General Remarks
SNP C>T;T>G at 193;482
SNP INS;INS;T>C;C>T;T>C;T>C at 9,1;26,1;327;523;705;706
SNP A>G at 519
Reference sequence CCCGTATCAGGATGATCCGTCTTGAAGCCAATTCTTGATGAGATAGAGCGTGGTGGTCCATCTGCAATGGTGAAGTAGGTATTGTGTGCGAGTATGGATACCTGATTACAGCTTAAAGTTGCTGAGATATTCTTCTTTACTTCAGGTACTGGAATGACCCTGAGATTCTTCAAAAGATTGGCCAGGCTATGTCATTGAACTTCCCAGTAGATGCTGCTACTTCCACTGTACTATCTGGACCTCAAGAAACTGATGAAGAAGGCGAGGATGATGATGAGTCCATTGTCCATAACACCGCCAGTGTCGGTGATGCAGAGGTAATTGCGTCAAAGAATATTGATAGGCCTTGCCTTCTAATTCTTTTCTGCTGCTAGTTGATTTACCAATTTTATTGGTATTTATCCATGTCAGTATCTTCATAAGGATGCTCTGTGCTACTTAGTGGTTAACATTTAGTGTTTACCACATTTGTCACTATGCAACCATTTTTTGGTTAAGGAAAGGCATGTATCTCCAACTAGGCTCACAAACTTTTATTTGTGTGGCTAAGGAATGCTCCCCCTCCCTTGATGGTTTTACATCATGATCAGGCTTCTTTGGTTTATATAGCCTGGCACTGTGCTTGTAAAATGAGTCATCTAATCTGTTTATTTAAAGGCAACTCACAAATTATCCTGTAATTTATGTGGATCCTGAAAATGGGTTTATTCTCAGATGATTGCTGTTCTTTGTGGTAGAACTATCTGAGCTTGAACAGGGCCATTTCTCACTGGATACCATAGCCTTGTTTTCTTTCTAAATGGGATTTCCCCTTAACTTGCGTTAGATGTGGTTTGACTTCTACCATCATCTTTTTACTTGCGCCTGAGGAAATCTCTATATGATATTGTTGTACTTATTTACTATTAAGTGCTGCATTGACAAGTTGAATACGACAACAGGGACTGA
Reference sequence CTTAAGTTGCTGAGATATTCTTCTTTACTTCAGGTACTGGAATGACCCTGAGATTCTTCAAAAGATTGGCCAGGCTATGTCATTGAACTTCCCAGTAGATGCTGCTACTTCCACTGTACTATCTGGACCTCAAGAAACTGATGAAGAAGGCGAGGATGATGATGAGTCCATTGTCCATAACACCGCCAGTGTCGGTGATGCAGAGGTAATTGCGTCAAAGAATATTGATAGGCCTTGCCTTCTAATTCTTTTCTGCTGCTAGTTGATTTACCAATTTTATTGGTATTTATCCATGTCAGTATCTTCATAAGGATGCTCTGTGCTACTTAGTGGTTAACATTTAGTGTTTACCACATTTGTCACTATGCAACCATTTTTTGGTTAAGGAAAGGCATGTATCTCCAACTAGGCTCACAAACTTTTATTTGTGTGGCTAAGGAATGCTCCCCCTCCCTTGATGGTTTTACATCATGATCAGGCTTCTTTGGTTTATATAGCCTACAGGCACTGTGCTTGTAAAATGAGTCATCTAATCTGTTTATTTAAAGGCAACTCACAAATTATCCTGTAATTTATGTGGATCCTGAAAATGGGTCCATTCTCAGATGATTGCTGTTCTTTGTGGTAGAACTATCTGAGCTTGAACAGGGCCATTTCTCACTGGATACCATAGCCTTGTTTTCTTTCTAAATGGGATTTCCCCTTAACTTGCGTTAGATGTGG
Type
EST
SNP
PCR primers
BE494426A_F2 CAATGGTGAAGTAGGTACTGT
BE494426_cpR1 CCTTGTTTGCTCCACCATCT
Sequence
NSFT03P2_Contig17373
Linkage Group
5A
Source Species
Triticum aestivum
Data Source
You, Frank Mingan2010.01