Query (optional)   in Class  

GrainGenes Probe Report: BE494426-5D

[ Printable Version ]  [ Submit comment/correction ]

Probe
BE494426-5D
Data at Wheat_SNP
BE494426-5D
Reference
ReferenceAkhunov ED et al. (2010) Nucleotide diversity maps reveal variation in diversity among wheat genomes and chromosomes. BMC Genomics 11:702.
General Remarks
SNP A>G;C>T;G>A;C>A;C>T at 18;162;375;551;574
SNP G>A;C>A;C>T at 210;386;409
Reference sequence TCATTGAACTTCCCAGTAGATGCTGCTACTTCCACTGTAGTATCTGGACCTCAAGAAACTGATGAAGAGGGCGAGGATGATGATGAGTCCATTGTCCATAACACCGCCAGTGTTGGTGATGCAGAGGTAATTGCGTCAAAGAATCTTCATAGGTGATTTACCAATTTTGTTGGTATTTATCCATGTTAGTATCCTTATAAGGATGCTCTGTGCTACTTAGTGGTTAACATTTAGTGTTTACCATATTTGTCACCGTGCAACCATTTTTTGGTTAAGGCAAGGCATGTATCTCCAACTTGGCTCACAAACTTATATTTTTGTGACGAAGGAATGCTCCCCTCCCTTGATGGTTTTACATCATGATCAGGCTTCTTTGGTTTATAGCCTACAGGCACCGTGCTTATAAAACGAGTCATCTAATCTGTTTATTCAAAGGCAACTCTCAAATTGTCCAGTAATTTACATGGATCCTGAAAATGGGTCCATTCTCAGATGATTGCTGTTCTCTGTGGTAGAACTATCTAAGCTTGAACAGGGCCATTTCTCACTGGATACCATAGCTTTGTTTTCTTTCTAAATAGGAATTCCACTGAACTTTGCACTAAATGTGGATTTACTTCTAGCATCGATCTTTTATTGGCGCCTGTGGTAGAACTATCTAAGCTTGAACAGGGCCATTTCTCACTGGATACCATAGCTTTGTTTTCTTTCTAAATAGGAATTCCACTGAACTTTGCACTAAATGTGGATTTACTTCTAGCATCGATCTTTTATTGGCGCCTGAGGAAATATCTATGAAATTGTTGTACTTATTTACTATTAAGTGCTGCAT
Reference sequence ATTCTTGATGAGATAGAACGTGGTGGTCCATCTGCAATGGTGAAGTAGGTATTGCATGCGAGTATGGATACCTGATTACAGCTTAAAGTTGCTGAGATATTCTTCTTTACTTCATGTAGGTACTGGAATGACCCTGAGATTCTTCAAAAGATTGGCCAGGCCATGTCATTGAACTTCCCAGTAGATGCTGCTACTTCCACTGTAGTATCTGGACCTCAAGAAACTGATGAAGAGGGCGAGGATGATGATGAGTCCATTGTCCATAACACCGCCAGTGTTGGTGATGCAGAGGTAATTGCGTCAAAGAATCTTCATAGGTGATTTACCAATTTTGTTGGTATTTATCCATGTTAGTATCCTTATAAGGATGCTCTGTGCTACTTAGTGGTTAACATTTAGTGTTTACCATATTTGTCACCGTGCAACCATTTTTTGGTTAAGGCAAGGCATGTATCTCCAACTTGGCTCACAAACTTATATTTTTGTGACGAAGGAATGCTCCCCTCCCTTGATGGTTTTACATCATGATCAGGCTTCTTTGGTTTATAGCCTACAGGCACCGTGCTTATAAAACGAGTCATCTAATCTGTTTATTCAAAGGCAACTCTCAAATTGTCCAGTAATTTACATGGATCCTGAAAATGGGTCCATTCTCAGATGATTGCTGTTCTCTGTGGTAGAACTATCTAAGCTTGAACAGGGCCATTTCTCACTGGATACCATAGCTTTGTTTTCTTTCTAAATAGGAATTCCACTGAACTTTGCACTAAATGTGGATTTACTTCTAGCATCGATCTTTTATTGGCGCCTGTGGTAGAACTATCTAAGCTTGAACAGGGCCATTTCTCACTGGATACCATAGCTTTGTTTTCTTTCTAAATAGGAATTCCACTGAACTTTGCACTAAATGTGGATTTACTTCTAGCATCGATCTTTTATTGGCGCCTGTGGTAGAACTATCTAAGCTTGAACAGGGCCATTTCTCACTGGATACCATAGCTTTGTTTTCTTTCTAAATAGGAATTCCACTGAACTTTGCACTAAATGTGGATTTACTTCTAGCATCGATCTTTTATTGGCGCCTGAGGAAATATCTATGAAATTGTTGTACTTATTTACTATTAAGTGCTGCATGACAAGCTG
Type
EST
SNP
PCR primers
BE494426_cpR1 CCTTGTTTGCTCCACCATCT
BE494426D_F2 AATGGTGAAGTAGGTACTGCA
Sequence
NSFT03P2_Contig17373
Linkage Group
5D
Source Species
Triticum aestivum
Data Source
You, Frank Mingan2010.01