Query (optional)   in Class  

GrainGenes Probe Report: BE494482-7A

[ Printable Version ]  [ Submit comment/correction ]

Probe
BE494482-7A
Data at Wheat_SNP
BE494482-7A
Reference
ReferenceAkhunov ED et al. (2010) Nucleotide diversity maps reveal variation in diversity among wheat genomes and chromosomes. BMC Genomics 11:702.
General Remarks
SNP INS;C>G at 61,1;300
SNP C>G at 300
SNP C>A;C>T;T>C;T>A;C>T at 53;54;56;57;95
Reference sequence TCTCCCTCCTCCATCACTCATCTCATCTCTAGTTGTATTAAATTGTGTACAACCCTTCCCTCTCAAGGACAGCACCACAAGATTGCATTCCATCCGTTGACTGGGAGTAATTGAATTGATTGCATTTGACTGTCAAAATGCTGAAGAATTCTTTCTTGTCTTTGGTACTATGGCCTTGTGCTGCAGGTGACCTGGGATGAACCGGACCTGCTGCAGAATGTGAAGAGGGTGAGCCCATGGCTGGTTGAGCTGGTCTCAAACATGCCGGCCATTCACCTCGCTCCGTTCTCGCCGCCCCGGAAGAAGCTCTGCGTTCCGTTCTACCCCGACCTCCCGGCCGACGGCCAGTTTCCAGCCCCCATGTTCCATGGAAACCCACTCGGACGCGGCGGCGGCGTCGGTCCGATGTGCTATTTCCCGGACGGCACTCCTGCAGGCATACAGGGAGCCAGGCATGCTCAATTTGGTATATCTTTATCAGATCTCCACCTTAACAAACTGCAGTCGAG
Reference sequence GACTGGGATTGACTGGGAGTAATTGAATTGATTGCATTTGACTGTCAAAATGCTGAAGAATTCTTTCTTGTCTTTGGTACTATGGCCTTGTGCTGCAGGTGACCTGGGATGAACCGGACCTGCTGCAGAATGTGAAGAGGGTGAGCCCATGGCTGGTTGAGCTGGTCTCAAACATGCCGGCCATTCACCTCGCTCCGTTCTCGCCGCCCCGGAAGAAGCTCTGCGTTCCGTTCTACCCCGACCTCCCGGCCGACGGCCAGTTTCCAGCCCCGATGTTCCACGGAAACCCACTCGGACGCCGCGGCGGCGTCGGTCCGATGTGCTATTTCCCGGACGGCACTCCTGCAGGCATACAGGGAGCCAGGCATGCTCAATTTGGTATACCTTTATCAGATCTCCACCTTAACAAACTGCAGTCGAG
Type
EST
SNP
PCR primers
BE494482A_F1 CATTCCATCTATTGACTGGG
BE494482_cpR1 CGTGTGGTGACAGACTCGAC
Sequence
NSFT03P2_Contig4487
Linkage Group
7A
Source Species
Triticum aestivum
Data Source
You, Frank Mingan2010.01