Query (optional)   in Class  

GrainGenes Probe Report: BE495175-3A

[ Printable Version ]  [ Submit comment/correction ]

Probe
BE495175-3A
Data at Wheat_SNP
BE495175-3A
Reference
ReferenceAkhunov ED et al. (2010) Nucleotide diversity maps reveal variation in diversity among wheat genomes and chromosomes. BMC Genomics 11:702.
General Remarks
SNP C>T at 317
SNP T>C;A>C at 43;87
Reference sequence CTGCCAAGGCTAGCTCTCAGATGTGCCAAATGATGTGGCTGTTCTTTATGTAGATCAATGTGTTGAAAAGGTTTGAGAAGTACTCCAACTTTATTTTTCTGTATGCTACTACTATGAACTTCTACACAAACAGCTGGCGAGACTGAGTGAGTGAACTAATTGCTCGATTGAGTTAACAACAGTGCAGTAGCTAAACTGCATTTTTCCTGGATGGCGTATCCTGGTTCCTGATTTATTCCATGTCTTATTAGGGCACTCTAACATCCTTAACTCAGCGCCACTAGCTTGTCATAGCCTATCAGGATCTCACCTACCTTTTTCAGCTCTTATTTTTTCTTAACTAGCTAGCTTATTTGCCTTAATAGCCCTGCACCTTATATCCATGCAGTTAGCAAGCAGTTATGACCCAAAGTTTGGTGGATTTGGCTCTGCTCCCAAGTTTCCAAGACCTGTTGAAGATTGCATAATGCTCTATAAATTCCGGAAACACATGGAAGCTAGGCAGGAGAGTGAAGCTCAAAACATAATGAAGATGGTAACTCATACACTGCAATGTATGGCTAGAGGTGGAGTTCATGACCATGTTGGAGGTGGTTTTCATAGATATAGTGTGGACGAGTGCTGGCATGGTAAGTTCACTTTAATCTCAAGGAGACATTTTCTTTTCATGTATTTGCAGAATTCATCTCTC
Reference sequence CCGGCGAGACTAAGTGAGTGAACTAATTGCTCGATTGAGTTAACAACAGTGCAGTAGCTAAACTGCATTTTTCCTGGATGGCGTATCCTGGTTCCTGATTTATTCCATGTCTTATTAGGGCACTCTAACATCCTTAACTCAGCGCCACTAGCTTGTCATAGCCTATCAGGATCTCACCTACCTTTTTCAGCTCTTATTTTTTCTTAACTAGCTAGCTTATTTGCCTTAATAGCCCTGCACCTTATATCCATGCAGTTAGCAAGCAGTTATGACCCAAAGTTTGGTGGATTTGGCTCTGCTCCCAAGTTTCCAAGACCTGTTGAAGATTGCATAATGCTCTATAAATTCCGGAAACACATGGAAGCTAGGCAGGAGAGTGAAGCTCAAAACATAATGAAGATGGTAACTCATACACTGCAATGTATGGCTAGAGGTGGAGTTCATGACCATGTTGGAGGTGGTTTTCATAGATATAGTGTGGACGAGTGCTGGCATGGTAAGTTCACTTTAATCTCAAGGAGACATTTTCTTTTCATGTATTTGCAGAATTCATCTCTCATATTTTCTCTCTGTGCAGTTCCACATTTTGAGAAGATGCTGTACGACCAGGG
Type
EST
SNP
PCR primers
BE495175A_F2 CAAACAGCTGGCGAGACTTAG
BE495175_cpR1 TTGGCTATCTGTCCCTGGTC
Linkage Group
3A
Source Species
Triticum aestivum
Data Source
You, Frank Mingan2010.01