Query (optional)   in Class  

GrainGenes Probe Report: BE495277-5A

[ Printable Version ]  [ Submit comment/correction ]

Probe
BE495277-5A
Locus
TTU047BE495277-1
Data at Wheat_SNP
BE495277-5A
Reference
ReferenceAkhunov ED et al. (2010) Nucleotide diversity maps reveal variation in diversity among wheat genomes and chromosomes. BMC Genomics 11:702.
General Remarks
SNP C>T;G>A;T>C;T>C;C>T at 113;427;667;794;861
SNP G>A;T>C at 427;667
Reference sequence TTTTTTTTTTCCGATCTAGCGTGGCCAGCGATCGCGCTGTCTGGATGGGGATTTTGATTGGGGTTAGGTTAGGGGTGCACGCGAAGAAACGGTGGGGGGTTTAGCATCTCTTCGGAATCGGCTCATCTGAGATTCCGGGTGGCGCGGGCGGCCCGAATTGAGCCGAGCCCTTGGTTTGAGAGGGGAATTTTGCCCTTCGGTGGCTGGCATGTCGCCTTGCAACTAATTTAGCTGTGCTCGTCTTCATCCTCGTCTTCTTCAGGGGTTGTAAACGTACAATCTCGGAAGGCTTGATGTGTTGGTGATGCGTGGTTGGCCTACATAGCTTGTATCTATTCACTACTAGATAATTTGGAACGCTTGGTTGGAGCTTCCGGGTGACAAGGAGAAAAATAATGCTGCATGCTGTATGGTTTGGGATTTAAGGAAGGCCATGAGTTAGATGAGGAACGCTTTCGTTGTTTGAGTCATTTAGAAGGCTTTCTCATTATGTTCGGCTTAGGTTTTTATCTTATATTGAATTAAACACTGCTTTGCACAATAATAACTAACTGAATACTATCATCAGTCTCATATGGTTGCTTCGCCTGTTCTCAGGGCGCCCGGCGGTCACGCAAAAACAAAGGGCACCATATACCTTTCTAACATAAGGATGGTGTTTGTCGCTGCCAAGCCTGTTGGCAACTTCTTTGCCTTTGATATGCCCCTGGTGAGCAAATGCATCCTGAAATGACCCTATTATCCCCTGTGAATCTGTGAAAGGAACAATTGATGTTGCTTCCTTAATAATAATTTCATTACATCATGAGTTTACAGCAAAATGTAAATTCTCTGACATGCCTAACTTGTTTGCAGCTGTACGTGCACGGTGAGAAGTTCAACCAACCGATATTTCACTGCAACAATATTTCTGGGTTCGTTGAGCCGGTGAGTGTCAC
Type
EST
SNP
PCR primers
BE495277A_R1 GGATGTACAAGCATTCTCCAA
BE495277_cpF1 GTTCCACGTCGACAAGATCC
Sequence
NSFT03P2_Contig4330
Linkage Group
5A
Source Species
Triticum aestivum
Data Source
You, Frank Mingan2010.01