Query (optional)   in Class  

GrainGenes Probe Report: BE495277-5B

[ Printable Version ]  [ Submit comment/correction ]

Probe
BE495277-5B  [ Marker Report ]
Locus
BE495277_339-5B
BE495277_339
TTU047BE495277-2
Data at Wheat_SNP
BE495277-5B
Reference
ReferenceAkhunov ED et al. (2010) Nucleotide diversity maps reveal variation in diversity among wheat genomes and chromosomes. BMC Genomics 11:702.
General Remarks
SNP G>T;C>G;G>A at 643;664;919
[ Show all 6 ]
Type
EST
SNP
PCR primers
BE495277B_R1 GGATGTGCAAGTATTCTCTGG
BE495277_cpF1 GTTCCACGTCGACAAGATCC
Sequence
NSFT03P2_Contig4330
Linkage Group
5B
Source Species
Triticum aestivum
Data Source
You, Frank Mingan2010.01