Query (optional)   in Class  

GrainGenes Probe Report: BE495277-5D

[ Printable Version ]  [ Submit comment/correction ]

Probe
BE495277-5D
Locus
BE495277
TTU047BE495277-3
Data at Wheat_SNP
BE495277-5D
Reference
ReferenceAkhunov ED et al. (2010) Nucleotide diversity maps reveal variation in diversity among wheat genomes and chromosomes. BMC Genomics 11:702.
General Remarks
SNP G>A;A>C;T>G;G>A;T>A;C>G;G>A;A>G;C>T;A>T at 146;207;208;367;382;498;501;650;656;666
[ Show all 6 ]
Type
EST
SNP
PCR primers
BE495277_cpF1 GTTCCACGTCGACAAGATCC
BE495277D_R1 TAGGATGTACAAATATTCTCCAG
Sequence
NSFT03P2_Contig4330
Linkage Group
5D
Source Species
Triticum aestivum
Data Source
You, Frank Mingan2010.01