Query (optional)   in Class  

GrainGenes Probe Report: BE495896-5A

[ Printable Version ]  [ Submit comment/correction ]

Probe
BE495896-5A
Data at Wheat_SNP
BE495896-5A
Reference
ReferenceAkhunov ED et al. (2010) Nucleotide diversity maps reveal variation in diversity among wheat genomes and chromosomes. BMC Genomics 11:702.
General Remarks
SNP A>G; at 299
Reference sequence CCGCTAGAACTGCGGCGCAGAAAGGAGCTCCAGGATGATGTTGGCTTTGTCGGCTTCCTTGAAAACTTTCAGGCATTTCTCGACGACGTTGCTGCTGAACTTTTGCATGGAGAGGTGGATGTACTTGCCTTCAAACTGCTGTGCCAGACTTGCATTTGCAGTAGCGACCTTTAGTTCTATCACATACTGAACAACATAGTTTCTGCAACATTAGCAGATAAGCTCATGAGTTTACAGGTTAAAATACACCAACATAAACATATAGAAGAATGAATTATGAACATACCGAGTAATACTTATTGAATGTGTATAAATTTAACTAGTTATGTTTAAAAAAATGTTTAACTAGATATCATGGCACTAAAGATTTGTAGGAATGTCTACAGAAATACAGAGGTCTCTACAATCAATGGTTTCCACTTTACAAAGGCATGCTGCCGGCTGGCCTACTAATGATATGCTAGACAGAACAATAATTGATTAATCATGCTTGTTTTACCGGTCTCGTGGTTACATGAAAAATTACTGGTGGAGTTCAAGGTAGGATTTTTACCCATAGGCATCTTGTGCAAGTTCGAACCCATTGCGAGCGATTGCGGCAACCAGCTTCTCCTTGTGCTCACCCGTCGAATCGCGCAATACACCGCTGCAGGACGCAGCAGCCATGGCATTGCATCCCGATATCAAGGCAATAAACAG
Type
EST
SNP
PCR primers
BE495896A_F1 GAAGCAACCGCTAGAACTGC
BE495896_cpR1 TGCTGCTGTTTATTGCCTTG
BE495896_cpR1 TTGGTCAGTGCTGAGTGGAGBF483362-5B
PCR_primers
Sequence
NSFT03P2_Contig7224
Linkage Group
5A
Source Species
Triticum aestivum
Data Source
You, Frank Mingan2010.01