Query (optional)   in Class  

GrainGenes Probe Report: BE495949-6A

[ Printable Version ]  [ Submit comment/correction ]

Probe
BE495949-6A
Data at Wheat_SNP
BE495949-6A
Reference
ReferenceAkhunov ED et al. (2010) Nucleotide diversity maps reveal variation in diversity among wheat genomes and chromosomes. BMC Genomics 11:702.
General Remarks
SNP C>G;G>C;C>A;T>A;T>A;C>T;G>T at 38;39;40;41;42;797;1166
Reference sequence ATTACAATATTAAAAATGGACTATTTTTACATCATCTCGCTTTGCAACCATGATATCGTAGATATGAAGTTCACATTTGTCGTACTTCTGGTAAGCTAATAGTGAGTGGGTCTTCTCCTTATAGAAGTATTACAAATATTAAAAATGGACTATTTTTACATCATCTGCAAATGCAACCATGATATCATAGATATGAAGTTCACATTGGTCGAACTTCTGGTAAGCTAATAGTGAGTGGGGCATGTAGTCACTCTTCTTTTACTAATTTATTGTCTTGGCTCAAAAGTCATTCATATTATGGACTTCTTTTGGCTGACACCCCATGTAACATACGCTACTATTACATATCCTGTCATGCGCTTGTTCTGTCATGATTGAAGCTTGATAATCCTTCCTGTTCATGCCCTCATGATCTCATGCATTGGATGGATTGGGAAGCTGTTCATGGTTTATGCTATGAATGATTTTTTTTCTTGAACTCTTGGTATGCCTGCATTTGTGAATTAAGGCAATTCTCTGTAGTCTCAACTGTAAAGCTATCATCTCATCTCGTCTGAGCCACGTCAATGTTCACACTGGACGGGAAAAAGTGTATTAGTTTATCATCTTTTGTATGCTTTAGGGCCATCCATAATAAAATTTGTTTCATGGGATCTGTTAGCCCAGTTTTAGACTTTTAGTTCATAAATACCCGGTAAGTAGGTATTGGGATTTATGATCGTCTGGACCCGATTATTTGTTTTTTCCAACATAATGCTGCGAACATTGTGCTGATATGCTGCTAGTATCAAACTGTCACCCAATTATTCATTTCCAGCACAATGCTGCTTTACTGCTAACACTTAACTGTTGCCTGTTTATTTTATCTTTAGCATACTGCTGCTAATACTGAACTGTAACCCAGTTATTTTATTTTCAGCGTATAATGCTGCTTATACCGAACTGTAGACCATTTATTTTATTTTCAGCGTTATGCTGCTTATACGAACTGTTGTTAACACTTTTGCATACAAAAATATTCAGGAGGAAGAGAAGAAGAAAGAGAAAGAAGAAAAGGCAAAACAAAAGAAGGAAGAGAAGGCAAAGCTCAAAGAACCAGAGGCTGATGAACAAGATTTAGCTTTAAATGAAATGACCGAGCCTACTGCTAGGGAAGAAGAAGAACGAGAGAA
Type
EST
SNP
Source Species
Triticum aestivum
Data Source
You, Frank Mingan2010.01