Query (optional)   in Class  

GrainGenes Probe Report: BE495949-6D

[ Printable Version ]  [ Submit comment/correction ]

Probe
BE495949-6D
Data at Wheat_SNP
BE495949-6D
Reference
ReferenceAkhunov ED et al. (2010) Nucleotide diversity maps reveal variation in diversity among wheat genomes and chromosomes. BMC Genomics 11:702.
General Remarks
SNP DEL;T>A;A>G;G>A;G>T at 5;16;289;302;1084
Reference sequence AAGTACTACAATATTTAAAATGGACTATTTTTACATCATCTGCAAATGCAACCATGATATCGTAGATATGAAGTTCACATTTGTCGTACTTCTGGTAAGCTAATAGTGAGTGGGTCTTCTCCTTATAGAAGTATTACAAATATTAAAAATGGACTATTTTTACATCATCTGCAAATGCAACCATGATATCATAGATATGAAGTTCACATTGGTCGAACTTCTGGTAAGCTAATAGTGAGCGGGGCATGTAGTCACTCTTCTTTTACTAATTTATTGTCTTGGCTCAAAAGTCATATTATGGGCTTCTTTTGTCTGACACCCCATGTAACATACGCTACTATTACATATCCTGTCATGCGATGAAGCTTGATAATCCTTCCTGTTCATGCCCTCATGACCTCATGCATTGGATGGATTGGGAAGCTGTTCATGGTTTATGCTATGAATGATTTTTTTCTTGAACTCTTGGTATGCCTGCATTTGTGAATTAAGGCAATTCTCTCTAGTCTCAACTGTAAAACTATCATCTCATCTCGTCTGAGCCACGTCAATGTTCACAGTGGATGGGAAAAGGTGTATTAGTTTATCATCTTTTGTATGGTTTAGGGCCATCCATAATAAAATTTGTTTCATGGGATCTGTTAGCCCAGTTTTAGACTTTTAGTTCATAAATACCTGGTAAGGTATTGGGATTTATGATCGTCTGGACCCGATTATTTTGTTTTTTCCAACATAATGCTGCGAACATTGTGCTGATATGCTGCTAGTATCAAACTGTTACCCAGTTATTCATTTCCAGCATAATGCTGCTTTACTGCTAACACTTAACTGTTGCCTGTTTATTTTATCTTTAGCATACTGCTGCTAATACTGAACTGTAACCCAATTATTTTATTTTCAGCGTATAATGCTGCTTATACCGAACTGTAGACCATTTATTTTATTTTCAGCATTATGCTGCTTACACGAACTGTTGTTAACACTTTTGCATACAAAAATATTCAGGAGGAAGAGAAGAAGAAAGAGAAAGAAGAAAAGGCAAAACAAAAGAAGGAAGAGAAGGCAAAGCTCAAAGAACCAGAGGCTGATGAACAAGATTTAGCTTTAAAGGAAATGACCGAGCCTACTGCTAGGGAAGAAGAAGAACTGAGAGAA
Type
EST
SNP
Source Species
Triticum aestivum
Data Source
You, Frank Mingan2010.01