Query (optional)   in Class  

GrainGenes Probe Report: BE497109-1D

[ Printable Version ]  [ Submit comment/correction ]

Probe
BE497109-1D
Data at Wheat_SNP
BE497109-1D
Reference
ReferenceAkhunov ED et al. (2010) Nucleotide diversity maps reveal variation in diversity among wheat genomes and chromosomes. BMC Genomics 11:702.
General Remarks
SNP T>C;C>T at 9;61
SNP C>T;A>G at 61;172
Reference sequence GGCGTCCCTGNCCACGCAGATGAAGATCTGGTACAGCTGGAACTTATCGAACGGGCCCTTCGCTGCACTGGATCACCGGCGCTCACGCCGGTGCCCGCCTGGATGACCTTCTTGATCTTCTCCAAGCTGTACAGGCCAAAGTCCGGCTTGATCCCTGCAATGACAATACCAATACGTACTCAATCAATGTGATGATTTCCTTTCCAAGAAAACGGCAGTCATGAGCCATGGATGCATGCATGCGTCACCTTTGGAGACGAGGCGAGAGAGGGGGTTGATCTTGCTACGGAGGGCGATGGCGGCTTGGAAGTAGGCCTTGTCGTCGAGGCCGGAGCAGACGCCGGACGTCTTCCAGGCGCTCTTCCAGCTGCTCTGGCCGTTGTTGCTGGGGCACTTGATGTTGCTCCAGAACTGCCTCAGACA
Type
EST
SNP
PCR primers
BE497109_cpF2 GTCTGAGGCAGTTCTGGAG
BE497109D_R1 GCACTCGATGAGCGTCTC
Sequence
NSFT03P2_Contig15404
Linkage Group
1D
Source Species
Triticum aestivum
Data Source
You, Frank Mingan2010.01