Query (optional)   in Class  

GrainGenes Probe Report: BE497169-3D

[ Printable Version ]  [ Submit comment/correction ]

Probe
BE497169-3D
Data at Wheat_SNP
BE497169-3D
Reference
ReferenceAkhunov ED et al. (2010) Nucleotide diversity maps reveal variation in diversity among wheat genomes and chromosomes. BMC Genomics 11:702.
General Remarks
SNP G>A;A>G at 138;346
SNP C>T;C>A at 132;273
SNP C>T;C>T;A>G at 135;185;346
Reference sequence CCTATCCTGTGCAGATTCACCTCCAGGAAATGTTGTTGTGTTGATCAATTCATTCCCATTAACTCTTGCACGCATTTCAAGTTCTGATCTGTGAGCTCGGTAATTGTAGCTCACAACACATCCCATCTGGCCAGCGCGCAACCTGAAAACCCAAGAATCTGCCCAGGCACATGCAGATCCATCACATGCACATCATTTCAATGCCCCTTTCATCTTGTTCTCAATTTTGTAATCATGCTGGCCTGCAAACCGTTGGAGCTGGTCATACCCAGCAAGAACTCCAGCTCCTGCCATTCCCGAGAGGATATTTGCACCGACCCCTCTGAATAGAGTGAAGAACCCTTCAGTGGAAACTATCTGTTTTACGGCATGGAAGGCGCTCCTGTATTTGAATGGCTGCCCTGAAGTTAACATCATTCTTCGTCGGAGTGTATCAAATGGGTAGGGCGCAGGC
Type
EST
SNP
PCR primers
BE497169_cpR1 gcctgcgcctacccatttgat
BE497169D_F1 TGATGCCATCTCCTATCCTGTGCAG
Sequence
WHE0765_B01_D01ZS
Linkage Group
3D
Source Species
Triticum aestivum
Data Source
You, Frank Mingan2010.01