Query (optional)   in Class  

GrainGenes Probe Report: BE497224-4D

[ Printable Version ]  [ Submit comment/correction ]

Probe
BE497224-4D
Data at Wheat_SNP
BE497224-4D
Reference
ReferenceAkhunov ED et al. (2010) Nucleotide diversity maps reveal variation in diversity among wheat genomes and chromosomes. BMC Genomics 11:702.
General Remarks
SNP T>C at 148
[ Show all 6 ]
Type
EST
SNP
PCR primers
BE497224_cpF1 GGAACATAAAGCTGCTAGCGAA
BE497224D_R1 CGTCACACCAAGGTATACAATCG
Sequence
NSFT03P2_Contig10161
Linkage Group
4D
Source Species
Triticum aestivum
Data Source
You, Frank Mingan2010.01