Query (optional)   in Class  

GrainGenes Probe Report: BE497368-5A

[ Printable Version ]  [ Submit comment/correction ]

Probe
BE497368-5A
Data at Wheat_SNP
BE497368-5A
Reference
ReferenceAkhunov ED et al. (2010) Nucleotide diversity maps reveal variation in diversity among wheat genomes and chromosomes. BMC Genomics 11:702.
General Remarks
SNP T>C at 274
SNP A>G at 4
Reference sequence ATAGCTTTATACCTTTATCCTGTTGAATTTAATTTCAAGAATTTCATTTCCAAAAGTTGGTGATGCTTGCCTTTGTTCCTTCAATATTCCTAGGAAAATGTTTGGTGTTTGACTAAACAAGTACTCATGTATAGTTAAAATTTGCTGTCATGAGTTCTTTGAGTCCATGCATGTGTATAGTACTTTGTCAAGAACCTTATTATATTGTGTTTGCAGAACATTAGTTAGTCCCTTGCCAAGCAGCCTTACATATGCTGGCAATCTTAAATAGGCTGTTATGGTAAGAATAATTGTTCTTTGGTTAGCAAAACAAGTTAGGACCTTAAAGTGACATTCTGATATTATCTTCGAATAACTGAATGCGCTAAGCTGCTATCAGCAGTGATTAGGATCTTTGTGAACACAGGCTATTGTCACCCATTAGCATGATCTCAGTTCATGTATTTCATGGTGAAGATGAGCTTAATATAAGATATAGCTTTTTTTTAGTATTATTCAGCACATTCTTTTCTATCCCTCTTTAATTTTGGCCCATCAACTGCAGGTTGAGCCGAAAAGGCGGAAATGGTAATCGCTTCAACAAAAACCATCCCCGGTGAGGAGATGCACTGTTTATG
Reference sequence AAAAAAATGGTGCAAAGAGGCCTTCAAATTCATACCCGAGTTCACCAAGTTCTGATTCTAAGGTCAGTGATTTTTTGTTCCTTTTTCTTGACAGTATTGTTTATTAATTTTCTGCTTGTAGATAGCTTTATACCTTTATCTTGTTGAATTTAATTTCAAGAATTTCATTTCCAAAAGTTGGTGATGCTTGCCTTTGTTCCTTCAATATTCCTAGGAAAATGTTTGGTGTTTGACTAAACAAGTACTCATGTATAGTTAAAATTTGCTGTCATGAGTTCTTTGAGTCCATGCATGTGTATAGTACTTTGTCAAGAACCTTATTATATTGTGTTTGCAGAACATTAGCTAGTCCCTTGCCAAGCAGCCTTACATATGCTGGCAATCTTAAATAGGCTGTTATGGTAAGAATGATTGTTCTTTGGTTAGCAAAACAAGTTAGGACCTTAAAGTGACATTCTGATATTATCTTCGAATAACTGAATGCGCTAAGCTGCTATCAGCAGTGATTAGGATCTTTGTGAACACAGGCTATTGTCACCCATTAGCATGATCTCAGTTCATGTATTTCATGGTGAAGATGAGCTTAATATAAGATATAGCTTTTTTTAGTATTATTCAGCACATTCTTTTCTATCCCTCTTTAATTTTGGCCCATCAACTGCAGGTTGAGCCGAAAGGCGGAAGAGGTAATCGCTTCAACAAAAACCATCCCCGGTGA
Type
EST
SNP
Sequence
NSFT03P2_Contig17297
Linkage Group
5A
Source Species
Triticum aestivum
Data Source
You, Frank Mingan2010.01