Query (optional)   in Class  

GrainGenes Probe Report: BE497368-5D

[ Printable Version ]  [ Submit comment/correction ]

Probe
BE497368-5D
Data at Wheat_SNP
BE497368-5D
Reference
ReferenceAkhunov ED et al. (2010) Nucleotide diversity maps reveal variation in diversity among wheat genomes and chromosomes. BMC Genomics 11:702.
General Remarks
SNP C>T;DEL;A>C;C>T at 219;627;657;703
SNP C>T;DEL;A>C;C>T at 80;488;518;564
Reference sequence GCTTGTAGGTGACTTTATGCCTTTATCTTATTGAATTTAATTTCAAGAATTTCATTTCCAAAAGTTGGTGGTTCTTGCCCTTGTTCCTTCAATATTCCTAGGAAAATGTTTGGTGTTTGACTAAACAAGTACTCATGTATAGTTAAAATTTGCTGTCATGAGTTCTTTGAGTTCATGCATGTGTATAGTACTTTGTCAAGAACCTTATTATATTGTGTTTGCAGAACATTAGTTAGTTCCTTGCCAAGCAGCCTTACATATGCTGGCAATCTTAAATAGGCTGTTATGGTAAGAATAATTGTTCTTTGGTTAGCAAAACAAGTTAGGACCTTAAAGTGACATTCTGATATTATTTTGGAATAATTGAATGCACTAAGCTGCTATCAGCAGTGATTAGGATCTTCTTTGTTATTGTCACCCATTAGCATGATCTCAGTTCATGTATTTCATGGTGAAGATGAGCTTAATATAAGATATAGCTTTTTTTTAGTAAAAGATATAGCTTATTCAGCACATTATTTTCTATCCCTCTTTAATTTTGGCCCATCAACTGCAGGTTGAGCCGAAAAGGCGGAAGAGGTAATCGCTTCAACAAAA
Reference sequence ATACTTTCTGTGCGCGGATTGTGCTAAAGAAAATGGTGCAAAGAGACCTTCAAATTCATACCCGAGTTCACCAAGTTCTGATTCTAAGGTCAGTGATTTTTTGTTCCTTTTTCTTGACAGTATTGTTTATTAATTTTCTGCTTGTAGGTAACTTTATGCCTTTATCTTATTGAATTTAATTTCAAGAATTTCATTTCCAAAAGTTGGTGGTTCTTGCCCTTGTTCCTTCAATATTCCTAGGAAAATGTTTGGTGTTTGACTAAACAAGTACTCATGTATAGTTAAAATTTGCTGTCATGAGTTCTTTGAGTTCATGCATGTGTATAGTACTTTGTCAAGAACCTTATTATATTGTGTTTGCAGAACATTAGTTAGTTCCTTGCCAAGCAGCCTTACATATGCTGGCAATCTTAAATAGGCTGTTATGGTAAGAATAATTGTTCTTTGGTTAGCAAAACAAGTTAGGACCTTAAAGTGACATTCTGATATTATTTTGGAATAATTGAATGCACTAAGCTGCTATCAGCAGTGATTAGGATCTTCTTTGTTATTGTCACCCATTAGCATGATCTCAGTTCATGTATTTCATGGTGAAGATGAGCTTAATATAAGATATAGCTTTTTTTTAGTAAAAGATATAGCTTATTCAGCACATTATTTTCTATCCCTCTTTAATTTTGGCCCATCAACTGCAGGTTGAGCCGAAAAGGCGGAAGAGGTAATCGCTTCAACAAAAACCATCCCCGGTGA
Type
EST
SNP
PCR primers
BE497368_cpR1 TGACGCCATAAACAGTGCAT
BE497368D_F1 TTAATTTTCTGCTTGTAGGTGAC
Sequence
NSFT03P2_Contig17297
Linkage Group
5D
Source Species
Triticum aestivum
Data Source
You, Frank Mingan2010.01