Query (optional)   in Class  

GrainGenes Probe Report: BE497375-7A

[ Printable Version ]  [ Submit comment/correction ]

Probe
BE497375-7A
Data at Wheat_SNP
BE497375-7A
Reference
ReferenceAkhunov ED et al. (2010) Nucleotide diversity maps reveal variation in diversity among wheat genomes and chromosomes. BMC Genomics 11:702.
General Remarks
SNP A>G at 191
SNP G>C at 385
Reference sequence GCGGCTTTACTGTTGGTGAGCTCTTGTTTTACCCTTCATCTTTGGCTCAGTTATTGCTTGGGATGCCACAATAGGCTTGTTGATGTTGTGTGGTAGTATATTCATAATTGTTTGGTGAGTAAATACTTTTTTCTACGTATTTTTACTTGGGCAGGTGCAGTCTTTACCGTATACATGTACTCTCCGTCTCCATACATTTTGATACTTAATATGGTTTCACATATTGTAGTATTTGGCGTTTTAGGGTCTTTAGTTCTGGTAATTGACGGTTGCCCCAGTTCGTAAAGAATAAATACCAGCTATTGTGCTTGTTTAATTTAAGGTCTCAACTTTCTGAACTGTATGTCATCAGGATCACATAACATGGTTTGTACTGACTGCAGCGTTAGGAACATCATTGATTTTGCCTGTGAGGTTTGTAGAAATGAGTTCACATGGTAATAACATTATTGTCCCATGTCACTACAAGCCTTAGTTGGACTTCTTTTCACAGATATGTTCCCATGAATGCTAGTTCCAGTATAACTCTTTTGCAAATGTTCTTTGAGAGGGCTTTACTTGCATACCGTGTGTTCCTGGTTCCTGCAGGTCATGGTGAATCGACTGGA
Reference sequence TCCGTCTCCATACATTTTGATACTTAATATGGTTTCACATATTGTAGTATTTGGCGTTTTAGGGTCTTTAGTTCTGGTAATTGACGGTTGCCTCAGTTCGTAAAGAATAAATACCAGCTATTGTGCTTGTTTAATTTAAGGTCTCAACTTTCTGAACTGTATGTCATCAGGATCACATAACATGGTTTGTACTGACTGCAGCCTTAGGAACATCATTGATTTTGCCTGTGAGGTTTGTAGAAATGAGTTCACATGGTAATAACATTATTGTCCCATGTCACTACAAGCCTTAGTTGGACTTCTTTTCACAGATATGTTCCCATGAATGCTAGTTCCAGTATAACTCTTTTGCAAATGTTCTTTGAGAGGGCTTTACTTGCATACCGTGTGTTCCTGGTTCCTGCAGGTCATGGTGAATCGACTGGAA
Type
EST
SNP
PCR primers
BE497375A_F1 CCGTATACATGTACTCTCCG
BE497375_cpR1 CATCTCTTCCCGATTTTCCA
Sequence
NSFT03P2_Contig17646
Linkage Group
7A
Source Species
Triticum aestivum
Data Source
You, Frank Mingan2010.01