Query (optional)   in Class  

GrainGenes Probe Report: BE497740-3B

[ Printable Version ]  [ Submit comment/correction ]

Probe
BE497740-3B
Data at Wheat_SNP
BE497740-3B
Reference
ReferenceAkhunov ED et al. (2010) Nucleotide diversity maps reveal variation in diversity among wheat genomes and chromosomes. BMC Genomics 11:702.
General Remarks
SNP G>A;G>A at 171;259
SNP G>A at 171
Reference sequence TTGTATGGTGAGGAAAGTTAAGGTTGCGACCTTCGTCCCATGACGCTTACAATTGGACATGGGATTAGTTATGTAATGGAGCCCTTTTTCCGGCGAATTGCAGCCACCTACTCTAATTGACCACGGGAGCAACTTTTTGGGGACGGCTATCAGTTATAATAATTGTTAGAGGATATTGATTTGCTTGAATCCTGGATTAAAGTGTTTGACTGGCATTTTCTATCTACGGTTTGATTATAGTGTTATAATTGATTCAATGTTCTGCTTTTCGTTTCAGCAACAATGACCAAGATTATTAAGGAGATGCTAC
Type
EST
SNP
PCR primers
BE497740B_F2 TGTATGGTGGGGAAAGTTAAGG
BE497740_cpR1 ACATCAGGCGGTAGCATCTC
Sequence
NSFT03P2_Contig15196
Linkage Group
3B
Source Species
Triticum aestivum
Data Source
You, Frank Mingan2010.01