Query (optional)   in Class  

GrainGenes Probe Report: BE497740-3D

[ Printable Version ]  [ Submit comment/correction ]

Probe
BE497740-3D
Data at Wheat_SNP
BE497740-3D
Reference
ReferenceAkhunov ED et al. (2010) Nucleotide diversity maps reveal variation in diversity among wheat genomes and chromosomes. BMC Genomics 11:702.
General Remarks
SNP G>C;C>G;T>C;T>C;T>C;G>A;A>G;DEL;T>G;G>A;C>G;C>T;C>T;T>C at 59;146;187;198;212;236;243;257-261;262;263;276;281;309;315
SNP G>C;C>G;T>C;T>C;T>C;G>A;A>G;C>G;DEL;T>G;G>A;C>G;C>T;C>T;T>C at 59;146;187;198;212;236;243;245;257-261;262;263;276;281;309;315
Reference sequence TTAGCCAAGGAAGATGAGCGATGTGTATGGTGGGGAAAGTTAGGTCTGCGACCTTCATGCCATGACGCTTACAATTGGGCATGGGATTAGTTATGTAATGGAACCCTTTTCCCGGCGAATTACACCCACCTACGCTAATTGACCACGGGAGCAACCTTTGGGGACAGCTATCAGTTATAATAATTGTTAGAAGATATTGATTTGCTTGAATTCTGGATTCAAGTGTTTGACTGACGCTTTCTATCTACGGTTTGATTATAGTGTTATAATTGATTCAACGCTCTGCTTTTCGTTTCAGCAACAATGACCAAGATTATTAAGGAGATGCTACCGCCTGATGTA
Type
EST
SNP
PCR primers
BE497740_cpR1 ACATCAGGCGGTAGCATCTC
BE497740D_F1 AGCCAAGGAAGATGAGCGATG
Sequence
NSFT03P2_Contig15196
Linkage Group
3D
Source Species
Triticum aestivum
Data Source
You, Frank Mingan2010.01