Query (optional)   in Class  

GrainGenes Probe Report: BE498566-2A

[ Printable Version ]  [ Submit comment/correction ]

Probe
BE498566-2A
Data at Wheat_SNP
BE498566-2A
Reference
ReferenceAkhunov ED et al. (2010) Nucleotide diversity maps reveal variation in diversity among wheat genomes and chromosomes. BMC Genomics 11:702.
General Remarks
SNP G>T at 622
SNP C>T at 532
SNP * at 164;271;279
Reference sequence GGGTCTTGGCTGCATGTTTGCTGGAATGGTATGACTGCCATGATAGTACAGTTGATATTATTGATAGCTTTCTTTTGTACTTTTGTTCAACTGGTGATGATCTTATGAATCATGTATTGTTGGTTGCAGATATTCCGCAAGGAACCATTTTTTTATGGCCATGACAACCATGATCAACTTGTTAAAATTGCAAAGGTGCTTATTAAGTTTATTCCTTTTATTCTTTGCAAAGATAGTTATAACTGATAAAAGGATTATTTTTGGTGGCATATGATATTCTTTAGAGTTGCTATATATCATTTGCTATTATTTACCTTAGTGACTGAGTGGTTCTGGCTCAATGTTTTGATTAATTTGTACTCATGCTCACATGTAATTACTAGCTTTACTCTATCTGTGTAGTCCTGTTTGAACTTAACATGAGCGCCAAAGTCTGACCACGCCCCTGTATTCACAGGTACTTGGAACAGATGGGCTAAATGCTTATTTGAACAAGTACAGAATTGAGCTTGACCCTCAGCTTGAAGCCCTCGTTGGAAGGTATATTGCCACCCAGCACTAATTTTGATGCAAGATCTCTATTTGTCATCTAATTTACAGTTTCTATAATTTCCACACAGGCACAGCAGAAAACCCTGGTCGAAGTTTATCAATGCAGACAACCAGCATCTAGTATCCCCTGAGGTCTGTCAATAATACATATATATCTCAAGTATACTTCACTAGCAGTAACCTGTTCCTGGTTTCTCAACGAGGCCTTTTCGTCTCCTTTTAGG
Reference sequence GCTGGAATGGTATGACTGCCATGATAGTACAGTTGATATTATTGATAGCTTTCTTTTGTACTTTTGTTCAACTGGTGATGATCTTATGAATCATGTATTGTTGGTTGCAGATATTCCGCAAGGAACCATTTTTCTATGGCCATGACAACCATGATCAACTTGTTAAAATTGCAAAGGTGCTTATTAAGTTTATTCCTTTTATTCTTTGCAAAGATAGTTATAACTGATAAAAGGATTATTTTTGGTGGCATATGATATTCTTTAGAGTTGCCATATATCATTTGCTATTATTTACCTTAGTGACTGAGTGGTTCTGGCTCAATGTTTTGATTAATTTGTACTCATGCTCACATGTAATTACTAGCTTTACTCACGCCCCTGTATTCACAGGTACTTGGAACAGATGGGCTAAATGCTTATTTGAACAAGTACAGAATTGAGCTTGACCCTCAGCTTGAAGCCCTTGTTGGAAGGTATATTGCCACCCAGCACTAATTTTGATGCAAGATCTCTATTTGTCATCTAATTTACAGTTTCTATAATTTCCACACAGGCACAGCAGAAAACCCTGGTCGAAGTTTATCAATGCAGACAACCAGCATCTAGTATCCCCTGAGGTCTGTCAATAATACATATATATCTCAAGTATACTTCACTAGCAGTAACCTGTTCCTGGTTTCTCAACGAGGCCTTTTCGTCTCCATTTTAGGCCATAGATTTCCTTGAT
Type
EST
SNP
PCR primers
BE498566A_R1 ATCTATGGCCTAAAATGGAGAC
BE498566_cpF1 GGACATGTGGAGTCTTGGCT
Sequence
NSFT03P2_Contig17866
Linkage Group
2A
Source Species
Triticum aestivum
Data Source
You, Frank Mingan2010.01