Query (optional)   in Class  

GrainGenes Probe Report: BE498892-2A

[ Printable Version ]  [ Submit comment/correction ]

Probe
BE498892-2A
Data at Wheat_SNP
BE498892-2A
Reference
ReferenceAkhunov ED et al. (2010) Nucleotide diversity maps reveal variation in diversity among wheat genomes and chromosomes. BMC Genomics 11:702.
General Remarks
SNP C>A;DEL;C>G;DEL;DEL;DEL;C>T;A>G;DEL;DEL;DEL;DEL;DEL;DEL;INS;T>G;A>T;C>T;DEL;DEL;G>A;T>C;C>A;T>C;C>A;T>C;T>C at 131;225-237;240;241;244-247;279;289;324;326-331;337-352;359-372;376-378;383-388;395-405;427,2;429;431;433;435-440;447;452;478;554;559;628;738;767
[ Show all 10 ]
Type
EST
SNP
PCR primers
BE498892A_R1 gattcaagaaagaagtcagatacataag
BE498892_cpF1 CTTCTTGGACAGCATGCAAA
Sequence
NSFT03P2_Contig18415
Linkage Group
2A
Source Species
Triticum aestivum
Data Source
You, Frank Mingan2010.01