Query (optional)   in Class  

GrainGenes Probe Report: BE499019-7,4B

[ Printable Version ]  [ Submit comment/correction ]

Probe
BE499019-7,4B
Data at Wheat_SNP
BE499019-7,4B
Reference
ReferenceAkhunov ED et al. (2010) Nucleotide diversity maps reveal variation in diversity among wheat genomes and chromosomes. BMC Genomics 11:702.
General Remarks
SNP C>T;C>T;C>A;A>C;T>G;A>T;A>T;G>T;G>A;G>C;G>C;INS at 46;49;89;245;258;266;298;299;306;309;322;328,1
Reference sequence TTTTCGGATTGGCGGGAAGGTACTACTGTTGTTAGCTGATCTTTACTCCTTCCTACCCTGCACCCTGCTTTAACAAAATGCATTTTACCTTACATCTCCGAATGGCTGACCTTTTTTCCTGTTGTTTTCAGTGTCCAGATACTAATTATTTGTTTATGGGGGATTATGTGGATCGTGGATACTACTCCGTTGAGACTGTTTCTGTAAGAGTCAATCTACTTGTGGATACTGCTCTATTCTTTCCAATGATACCATGTTCGAATTCATGTTATATGTACTTAATGATATTTCTTATCCAGCTCTTGGTAGCACTGAAGGTTCGCCACCCACA
Type
EST
SNP
Sequence
NSFT03P2_Contig18071
Source Species
Triticum aestivum
Data Source
You, Frank Mingan2010.01