Query (optional)   in Class  

GrainGenes Probe Report: BE499248-7A

[ Printable Version ]  [ Submit comment/correction ]

Probe
BE499248-7A
Data at Wheat_SNP
BE499248-7A
Reference
ReferenceAkhunov ED et al. (2010) Nucleotide diversity maps reveal variation in diversity among wheat genomes and chromosomes. BMC Genomics 11:702.
General Remarks
SNP G>A at 23
SNP G>C;A>G;A>G;A>G;A>G;C>T;C>A;A>C;C>T;T>C at 312;313;319;331;334;338;339;353;357;358
Reference sequence CTCCCTCACTTCTCCGCTCCCAGATCCACCGCTCCCAATTCACCAAGAAACTGAAACCGGAATGAAACAGATCTTGGCCATGGACATCAACCGCGAGAACTACGAGCTGGGGCTGCCGTGCATCGAGAAGGCCGGCGTGGCGCACAAGATCGACTTCCGCGAGGGCCCGGCGCTGCCGGTGCTGGACGCGCTGCTGGAGGACGAGGCCAACCACGGCACCTTCGACTTCGTCTTCGTGGACGCCGACAAGGACAACTACCTCAACTACCACGAGCGCCTCATGAAGCTCGTCAAGCTCGGCGGCCTCCTCGGCTAC
Reference sequence GAGGCGCTCGTGGTAGTTGAGGTAGTTGTCCTTGTCGGCGTCCACGAAGACGAAGTCGAAGGTGCCGTGGTTGGCCTCGTCCTCCAGCAGCGCGTCCAGCACCGGCAGCGCCGGGCCCTCGCGGAAGTCGATCTTGTGCGCCACGCCGGCCTTCTCGATGCACGGCAGCCCCAGCTCGTAGTTCTCGCGGTTGATGTCCATGGCCAAGATCTGTTTCATTCCGGTTTCAGTTTCTTGGTGAATTGGGAGCGGTGGATCTGGGAGCGGAGAAGTGAGGGAGCTTACGGTGCCGTCGTCGGGGATGGCGAGCGGAGTGGCAAGGAGGGAGCAACCAGTGCCGACGGAAATTTCCATGGCTTTCTTGGCTCCTATG
Type
EST
SNP
PCR primers
BE499248A_F1 GGCACCGTAAGCTCCCTCAC
BE499248_cpR1 GTTCCAGAGGGTGTTGTCGT
Sequence
NSFT03P2_Contig16537
Linkage Group
7A
Source Species
Triticum aestivum
Data Source
You, Frank Mingan2010.01