Query (optional)   in Class  

GrainGenes Probe Report: BE499248-7B

[ Printable Version ]  [ Submit comment/correction ]

Probe
BE499248-7B
Data at Wheat_SNP
BE499248-7B
Reference
ReferenceAkhunov ED et al. (2010) Nucleotide diversity maps reveal variation in diversity among wheat genomes and chromosomes. BMC Genomics 11:702.
General Remarks
SNP A>T;G>C;C>G at 63;270;345
[ Show all 6 ]
Type
EST
SNP
PCR primers
BE499248B_F2 TCTACACCGGCTACTCCCTG
BE499248_cpR1 GTTCCAGAGGGTGTTGTCGT
Sequence
NSFT03P2_Contig16537
Linkage Group
7B
Source Species
Triticum aestivum
Data Source
You, Frank Mingan2010.01