Query (optional)   in Class  

GrainGenes Probe Report: BE499248-7D

[ Printable Version ]  [ Submit comment/correction ]

Probe
BE499248-7D
Data at Wheat_SNP
BE499248-7D
Reference
ReferenceAkhunov ED et al. (2010) Nucleotide diversity maps reveal variation in diversity among wheat genomes and chromosomes. BMC Genomics 11:702.
General Remarks
SNP C>T at 166
SNP T>C at 198
Reference sequence CGCTCGCCATCCCTGAAGACGGCACCGTAAGCTCCTAACTTCTCCACTCCAGATCTACCACTCCCAATTTACCAAGAAACTGAAGAAAAATGAAAATGAAACGGAAATGCAGATCTTGGCCATGGACATCAACCGCGAGAACTACGAGCTGGGGCTGCCGTGCATCGAGAAGGCCGGCGTGGCGCACAAGATCGACTTCCGCGAGGGCCCGGCGCTCCCGGTGCTGGACGCGCTGCTGGAGGACGAGGCCAACCACGGCACCTTCGACTTCGTCTTCGTGGACGCCGACAAGGACAACTACCTCAACTACCACGAGCGCCTCATGAAGCTCGTCAAGGTCGGCGGCCTCCTCGGCTACGACAACAC
Reference sequence GGCGTCTACCCGGCTACTCCCTCCTCGCCCCGCGCTCGCCATCCCTGAAGACGGCACCGTAAGCTCCTAACTTCTCCACTCCAGATCTACCACTCCCAATTTACCAAGAAACTGAAGAAAAATGAAAATGAAACGGAAATGCAGATCTTGGCCATGGACATCAACCGCGAGAACTACGAGCTGGGGCTGCCGTGCATTGAGAAGGCCGGCGTGGCGCACAAGATCGACTTCCGCGAGGGCCCGGCGCTCCCGGTGCTGGACGCGCTGCTGGAGGACGAGGCCAACCACGGCACCTTCGACTTCGTCTTCGTGGACGCCGACAAGGACAACTACCTCAACTACCACGAGCGCCTCATGAAGCTCGTCAAGGTCGGCGGCCTCCTCGGCTACGACAAC
Type
EST
SNP
PCR primers
BE499248_cpR1 GTTCCAGAGGGTGTTGTCGT
BE499248D_F1 GCGCTCGCCATCCCTGAA
Sequence
NSFT03P2_Contig16537
Linkage Group
7D
Source Species
Triticum aestivum
Data Source
You, Frank Mingan2010.01