Query (optional)   in Class  

GrainGenes Probe Report: BE499478-2B

[ Printable Version ]  [ Submit comment/correction ]

Probe
BE499478-2B
Data at Wheat_SNP
BE499478-2B
Reference
ReferenceAkhunov ED et al. (2010) Nucleotide diversity maps reveal variation in diversity among wheat genomes and chromosomes. BMC Genomics 11:702.
General Remarks
SNP DEL at 597
[ Show all 7 ]
Type
EST
SNP
PCR primers
BE499478B_R3 CATCACTCCGAGCATTCTGC
BE499478_cpF1 AGGGCTTGCTTTTCACAAGA
Sequence
NSFT03P2_Contig12183
Linkage Group
2B
Source Species
Triticum aestivum
Data Source
You, Frank Mingan2010.01