Query (optional)   in Class  

GrainGenes Probe Report: BE499652-7A

[ Printable Version ]  [ Submit comment/correction ]

Probe
BE499652-7A
Data at Wheat_SNP
BE499652-7A
Reference
ReferenceAkhunov ED et al. (2010) Nucleotide diversity maps reveal variation in diversity among wheat genomes and chromosomes. BMC Genomics 11:702.
General Remarks
SNP G>A;DEL;C>T;A>T;G>A at 65;66-72;286;302;391
Reference sequence AGTGAGTGGATAAAGAAAAAAGATTAAAAAAATGTATCATGGATTATATATGTTTGCACTTGCAGACTGCAGTATGCCGAACAACAACTGCTATGAGAATGTTTGCATTATATGTATGCATGTATAGAAAAAATCAATAAAATTTAGAACATTTAACGAGTTCCTTCTCCTAAAGTAATCACTTAAGATTAAAAATAAATTTGCATAAGGTGTGGTTAGTATGTTGCAGAGGTTTGCTGGGCCCTTTTGTGAACACTAAGACCAAGAAACTACCTAAGAAATCTGCCAACTAACTTTTAATACTCTCTGCGTGTACTTAATAATTCAATTAATGAAGATCTGAATAGCACTCTGATACAGGAGTTATCTGCTGTAGCAAACAGTATTGGTGAAACCTTTTTGACTATTGGGCTCTTTGTTAAGTGTAAAGTACATGGTTCAGTATGCTGAAACAATGGGTGGACAAACTTACAGTGGTAATATTTGCCTGTTGAACGTGCATCAGTCATGACATTGCCAATCATTTCGGAGTATATCTGGAAGGAGCACAAACTCATGTCATGACATGACACTAAAAGCTTCATATGCATGAAATGTCCTGATTCCACATTAGACTAAGCGAATGATCTAAGCATCCAGATCTATGCTAGCCCGGTAGTTCACGAAGCGCAATAAATTCATTCGACAAACACTGAGCATGGGATGCAAAATCAGGAAGCATCGAGATATTTCGGTTTTCAGACCACTTAGTTCTAGGTCAACCCCCCTTCAACTGAAGATGACACAACCGATTCGTTCAAATGTTATCGTAGAAAGTAGTTTACTGATTGAGTGATTTCTGATTTAGTCAATGCTCTTTCACTATTTTACTCATGCCCCCAAGATGTTAAGAATAGTATGTGCTTGACATTTAGTCATTTATATCTTCCCATTCTCCAAATAGTCAACGCAGTGTGCTTTATATCTAATCCATACATACTTTATCACCGTATCGGTGCAATATGAGTGTTTCCGTACAAGCTAAATCCCTGCAAACTAGACTACGCTAGCAGACAACTAGGGAA
Type
EST
SNP
PCR primers
BE499652B_R2 CACCGATGAGTGCAACATTAA
BE499652_cpF1 TCCCAACAAGCTTTGGATTC
Sequence
NSFT03P2_Contig18553
Linkage Group
7A
Source Species
Triticum aestivum
Data Source
You, Frank Mingan2010.01