Query (optional)   in Class  

GrainGenes Probe Report: BE500291-5D

[ Printable Version ]  [ Submit comment/correction ]

Probe
BE500291-5D
Data at Wheat_SNP
BE500291-5D
Reference
ReferenceAkhunov ED et al. (2010) Nucleotide diversity maps reveal variation in diversity among wheat genomes and chromosomes. BMC Genomics 11:702.
General Remarks
SNP A>G at 357
SNP T>C;G>A at 480;512
Reference sequence AGTAAGGGGATTAGACAGAGGATAGTTGTGAACGAACGGGAAGGTTGACTAGAGGCTACTGTGCTGGTTTGTCGCCAAATTTAGGATGTCCTTCTCCAGCTCCGACCACTGCCGCCGCCTCTCGATCTCCACCTCAAGTGAGCCTCTGGAAAATTCTTCTCCAAAATGCTCTCTTCTCCATTGATGTTTCCCTCTATTAATTTGACGCTGCTGCAACCACACGGGATAGCAACCAACGCGATCCGGGCTCACCACTGGTGACCACCAGAGCATAGCGGGTCGCCTTGCTGACAAGCTCCCAGTGGTTGCCCTCATCTGTTCCTCTGGTTGTCTCTCGTGCCGCAGCCCTGCCTTGCTGGCACATTGGCCTGCTCGCATGGCAACTAATTAACATGGCTGTGCTGACAGGTGGACTCAGCTGGTCAGTTTTATTGTCAAAACGACTCAATATTTGTCACCGCATCCACAAAACAACCTGTTGTTTTGCGCAATTGCCTCCTTGTAGTATGGTGCAAAAAATCTCGCCTTCCCTTCCAGTGGTCAAACCTCTAAAGACAACAACCTACACGGACACTGACTTGTGGTTATTTGTTACCGCCAAACCACCTGTTGTCTTGCACAATTAACTTCTTGTAGTATGGTAACAATAAACCGACATGAACACTTAGTCAGAACTAATATTTGGTTGTTTGATGCTGTGCATTTGTACATTTTTTCCAAAATTTATCTCCATGTACTTAGTTTATCCCAGAAGTGTCGTTATTCTAACA
Reference sequence ATCTGAATATCGGACTCTGTGCAGTACTAACTTTGCACATCAGATGTCAAATCTGTCCTTAGTTTTCTCTGTTTACTTGGTCTCATTTTGTACAACTTTTTTAATGCTTCGTTGTGACACGTATACAATTCTTAGATTTATCTTCTCTTTTAACAGAGTTGATTGCGCAAAACCACAGGTTTTTGGCTGTGTTAACACAAATGGGCAGGTTGTGGATATTTTATAAAAACAACCACGACTTCTGAGGTAGCCTGTAGTGCTACACCCAAACCTTTCACGGTGAAAATGACAGATAGAGCCTAGACACTCACGTCGAATTACTCATGCCTCATGCTTAAGTGGACATGGGCTGATGGACTCCACAAGTCAGGTCCTCCTATTCTTTCTGTCTCTCATGCCAATGCCACTGTCTCGATCTCATTCTCATTCTCATCTCTCCTGATGTGACTGGAAGCAGCCATGCAGTGACCTTGATTCGGCAATTCTCTGGTCACAATTGGGAGCTGGGACCAGCAGCCATGGCCTTTGTCGGCTGCGCTTGGCTACCCACATCGGAAAGGAGGAATGGAGTATGGATTAGGGGGGGGGTTGGTGCATGCAAAGTCCTGGTTTGCCAGAAACTCATGTGTTTTACTTGGA
Type
EST
SNP
PCR primers
BE500291_cpR1 TGGGACAAAGTCACGCATAA
BE500291D_F1 GATAGAGCCTAGACACTCAC
Sequence
NSFT03P2_Contig17565
Linkage Group
5D
Source Species
Triticum aestivum
Data Source
You, Frank Mingan2010.01